ID: 991550769

View in Genome Browser
Species Human (GRCh38)
Location 5:67833567-67833589
Sequence GGCTTTGGAATGCCTCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991550760_991550769 19 Left 991550760 5:67833525-67833547 CCTGTTAAAGGCAACCTCCTATT No data
Right 991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG No data
991550763_991550769 5 Left 991550763 5:67833539-67833561 CCTCCTATTATGTACAGTGGGAG No data
Right 991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG No data
991550759_991550769 24 Left 991550759 5:67833520-67833542 CCTGTCCTGTTAAAGGCAACCTC No data
Right 991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG No data
991550764_991550769 2 Left 991550764 5:67833542-67833564 CCTATTATGTACAGTGGGAGACC No data
Right 991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991550769 Original CRISPR GGCTTTGGAATGCCTCATGT AGG Intergenic
No off target data available for this crispr