ID: 991552573

View in Genome Browser
Species Human (GRCh38)
Location 5:67856940-67856962
Sequence CTGCTACGTAATTCCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991552570_991552573 -4 Left 991552570 5:67856921-67856943 CCATTTTACTACAGACCTCCTGC No data
Right 991552573 5:67856940-67856962 CTGCTACGTAATTCCACTGATGG No data
991552568_991552573 -2 Left 991552568 5:67856919-67856941 CCCCATTTTACTACAGACCTCCT No data
Right 991552573 5:67856940-67856962 CTGCTACGTAATTCCACTGATGG No data
991552569_991552573 -3 Left 991552569 5:67856920-67856942 CCCATTTTACTACAGACCTCCTG No data
Right 991552573 5:67856940-67856962 CTGCTACGTAATTCCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991552573 Original CRISPR CTGCTACGTAATTCCACTGA TGG Intergenic
No off target data available for this crispr