ID: 991554506

View in Genome Browser
Species Human (GRCh38)
Location 5:67880519-67880541
Sequence TAGGGGCCCCAGCAGTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991554506_991554511 -2 Left 991554506 5:67880519-67880541 CCAGTAGACTGCTGGGGCCCCTA No data
Right 991554511 5:67880540-67880562 TATTCCCAGAGTGGCTACAGAGG No data
991554506_991554512 -1 Left 991554506 5:67880519-67880541 CCAGTAGACTGCTGGGGCCCCTA No data
Right 991554512 5:67880541-67880563 ATTCCCAGAGTGGCTACAGAGGG No data
991554506_991554513 0 Left 991554506 5:67880519-67880541 CCAGTAGACTGCTGGGGCCCCTA No data
Right 991554513 5:67880542-67880564 TTCCCAGAGTGGCTACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991554506 Original CRISPR TAGGGGCCCCAGCAGTCTAC TGG (reversed) Intergenic
No off target data available for this crispr