ID: 991554512

View in Genome Browser
Species Human (GRCh38)
Location 5:67880541-67880563
Sequence ATTCCCAGAGTGGCTACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991554505_991554512 0 Left 991554505 5:67880518-67880540 CCCAGTAGACTGCTGGGGCCCCT No data
Right 991554512 5:67880541-67880563 ATTCCCAGAGTGGCTACAGAGGG No data
991554506_991554512 -1 Left 991554506 5:67880519-67880541 CCAGTAGACTGCTGGGGCCCCTA No data
Right 991554512 5:67880541-67880563 ATTCCCAGAGTGGCTACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991554512 Original CRISPR ATTCCCAGAGTGGCTACAGA GGG Intergenic
No off target data available for this crispr