ID: 991564695

View in Genome Browser
Species Human (GRCh38)
Location 5:67992562-67992584
Sequence TCTTGGGGCCATGGTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991564689_991564695 3 Left 991564689 5:67992536-67992558 CCCAAAGCAGTCAGCAAAACATC No data
Right 991564695 5:67992562-67992584 TCTTGGGGCCATGGTCAAAGAGG No data
991564690_991564695 2 Left 991564690 5:67992537-67992559 CCAAAGCAGTCAGCAAAACATCT No data
Right 991564695 5:67992562-67992584 TCTTGGGGCCATGGTCAAAGAGG No data
991564686_991564695 18 Left 991564686 5:67992521-67992543 CCACCCTGATAGCGGCCCAAAGC No data
Right 991564695 5:67992562-67992584 TCTTGGGGCCATGGTCAAAGAGG No data
991564688_991564695 14 Left 991564688 5:67992525-67992547 CCTGATAGCGGCCCAAAGCAGTC No data
Right 991564695 5:67992562-67992584 TCTTGGGGCCATGGTCAAAGAGG No data
991564687_991564695 15 Left 991564687 5:67992524-67992546 CCCTGATAGCGGCCCAAAGCAGT No data
Right 991564695 5:67992562-67992584 TCTTGGGGCCATGGTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991564695 Original CRISPR TCTTGGGGCCATGGTCAAAG AGG Intergenic
No off target data available for this crispr