ID: 991565798

View in Genome Browser
Species Human (GRCh38)
Location 5:68003118-68003140
Sequence AACCATCAAAAACCAAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991565798_991565802 0 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565802 5:68003141-68003163 CACTGTGGTTGCAGTGTGGCTGG No data
991565798_991565807 21 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565807 5:68003162-68003184 GGGAGGGCTCAGGCCCACCTAGG No data
991565798_991565804 4 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565804 5:68003145-68003167 GTGGTTGCAGTGTGGCTGGGAGG No data
991565798_991565805 5 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565805 5:68003146-68003168 TGGTTGCAGTGTGGCTGGGAGGG No data
991565798_991565810 30 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG No data
991565798_991565806 11 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565806 5:68003152-68003174 CAGTGTGGCTGGGAGGGCTCAGG No data
991565798_991565803 1 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565803 5:68003142-68003164 ACTGTGGTTGCAGTGTGGCTGGG No data
991565798_991565808 22 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565808 5:68003163-68003185 GGAGGGCTCAGGCCCACCTAGGG No data
991565798_991565809 27 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565809 5:68003168-68003190 GCTCAGGCCCACCTAGGGTTTGG No data
991565798_991565801 -4 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565801 5:68003137-68003159 GGTTCACTGTGGTTGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991565798 Original CRISPR AACCATCAAAAACCAAAACT GGG (reversed) Intergenic
No off target data available for this crispr