ID: 991565799

View in Genome Browser
Species Human (GRCh38)
Location 5:68003119-68003141
Sequence GAACCATCAAAAACCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991565799_991565806 10 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565806 5:68003152-68003174 CAGTGTGGCTGGGAGGGCTCAGG No data
991565799_991565802 -1 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565802 5:68003141-68003163 CACTGTGGTTGCAGTGTGGCTGG No data
991565799_991565810 29 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG No data
991565799_991565804 3 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565804 5:68003145-68003167 GTGGTTGCAGTGTGGCTGGGAGG No data
991565799_991565807 20 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565807 5:68003162-68003184 GGGAGGGCTCAGGCCCACCTAGG No data
991565799_991565809 26 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565809 5:68003168-68003190 GCTCAGGCCCACCTAGGGTTTGG No data
991565799_991565805 4 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565805 5:68003146-68003168 TGGTTGCAGTGTGGCTGGGAGGG No data
991565799_991565808 21 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565808 5:68003163-68003185 GGAGGGCTCAGGCCCACCTAGGG No data
991565799_991565811 30 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565811 5:68003172-68003194 AGGCCCACCTAGGGTTTGGTGGG No data
991565799_991565801 -5 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565801 5:68003137-68003159 GGTTCACTGTGGTTGCAGTGTGG No data
991565799_991565803 0 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565803 5:68003142-68003164 ACTGTGGTTGCAGTGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991565799 Original CRISPR GAACCATCAAAAACCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr