ID: 991565810

View in Genome Browser
Species Human (GRCh38)
Location 5:68003171-68003193
Sequence CAGGCCCACCTAGGGTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991565799_991565810 29 Left 991565799 5:68003119-68003141 CCAGTTTTGGTTTTTGATGGTTC No data
Right 991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG No data
991565798_991565810 30 Left 991565798 5:68003118-68003140 CCCAGTTTTGGTTTTTGATGGTT No data
Right 991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991565810 Original CRISPR CAGGCCCACCTAGGGTTTGG TGG Intergenic
No off target data available for this crispr