ID: 991566026

View in Genome Browser
Species Human (GRCh38)
Location 5:68005260-68005282
Sequence GCAGATAGTAGGTATAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991566026_991566029 25 Left 991566026 5:68005260-68005282 CCTTCTTTATACCTACTATCTGC No data
Right 991566029 5:68005308-68005330 TGTTCAGGTTATTCAGTACTTGG No data
991566026_991566028 10 Left 991566026 5:68005260-68005282 CCTTCTTTATACCTACTATCTGC No data
Right 991566028 5:68005293-68005315 CTTTCTCTAAATGTTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991566026 Original CRISPR GCAGATAGTAGGTATAAAGA AGG (reversed) Intergenic
No off target data available for this crispr