ID: 991566910

View in Genome Browser
Species Human (GRCh38)
Location 5:68014821-68014843
Sequence ATATGCCAGGGGCCTTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991566905_991566910 4 Left 991566905 5:68014794-68014816 CCAACTGTGATCTGTATGGAGAA No data
Right 991566910 5:68014821-68014843 ATATGCCAGGGGCCTTGCTTGGG No data
991566904_991566910 5 Left 991566904 5:68014793-68014815 CCCAACTGTGATCTGTATGGAGA No data
Right 991566910 5:68014821-68014843 ATATGCCAGGGGCCTTGCTTGGG No data
991566903_991566910 6 Left 991566903 5:68014792-68014814 CCCCAACTGTGATCTGTATGGAG No data
Right 991566910 5:68014821-68014843 ATATGCCAGGGGCCTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991566910 Original CRISPR ATATGCCAGGGGCCTTGCTT GGG Intergenic
No off target data available for this crispr