ID: 991568392

View in Genome Browser
Species Human (GRCh38)
Location 5:68029231-68029253
Sequence CAAGCTGCTCCCTCTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991568392_991568393 -10 Left 991568392 5:68029231-68029253 CCTCTTTAAGAGGGAGCAGCTTG No data
Right 991568393 5:68029244-68029266 GAGCAGCTTGTATCCTTAGAAGG No data
991568392_991568396 11 Left 991568392 5:68029231-68029253 CCTCTTTAAGAGGGAGCAGCTTG No data
Right 991568396 5:68029265-68029287 GGACCACTGAGGTCAACAACAGG No data
991568392_991568394 0 Left 991568392 5:68029231-68029253 CCTCTTTAAGAGGGAGCAGCTTG No data
Right 991568394 5:68029254-68029276 TATCCTTAGAAGGACCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991568392 Original CRISPR CAAGCTGCTCCCTCTTAAAG AGG (reversed) Intergenic
No off target data available for this crispr