ID: 991568396

View in Genome Browser
Species Human (GRCh38)
Location 5:68029265-68029287
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991568392_991568396 11 Left 991568392 5:68029231-68029253 CCTCTTTAAGAGGGAGCAGCTTG No data
Right 991568396 5:68029265-68029287 GGACCACTGAGGTCAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr