ID: 991570669

View in Genome Browser
Species Human (GRCh38)
Location 5:68050221-68050243
Sequence GGAATTCTGTCCTGGGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991570669_991570677 -4 Left 991570669 5:68050221-68050243 CCTATAGCCCAGGACAGAATTCC No data
Right 991570677 5:68050240-68050262 TTCCTGGGCCAGGGGAAATCTGG No data
991570669_991570680 9 Left 991570669 5:68050221-68050243 CCTATAGCCCAGGACAGAATTCC No data
Right 991570680 5:68050253-68050275 GGAAATCTGGAAGAACTCCACGG No data
991570669_991570681 10 Left 991570669 5:68050221-68050243 CCTATAGCCCAGGACAGAATTCC No data
Right 991570681 5:68050254-68050276 GAAATCTGGAAGAACTCCACGGG No data
991570669_991570683 27 Left 991570669 5:68050221-68050243 CCTATAGCCCAGGACAGAATTCC No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991570669 Original CRISPR GGAATTCTGTCCTGGGCTAT AGG (reversed) Intergenic