ID: 991570672

View in Genome Browser
Species Human (GRCh38)
Location 5:68050228-68050250
Sequence TGGCCCAGGAATTCTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991570672_991570681 3 Left 991570672 5:68050228-68050250 CCCAGGACAGAATTCCTGGGCCA No data
Right 991570681 5:68050254-68050276 GAAATCTGGAAGAACTCCACGGG No data
991570672_991570680 2 Left 991570672 5:68050228-68050250 CCCAGGACAGAATTCCTGGGCCA No data
Right 991570680 5:68050253-68050275 GGAAATCTGGAAGAACTCCACGG No data
991570672_991570685 29 Left 991570672 5:68050228-68050250 CCCAGGACAGAATTCCTGGGCCA No data
Right 991570685 5:68050280-68050302 CCAGATTGCCCAGGCATCAGAGG No data
991570672_991570683 20 Left 991570672 5:68050228-68050250 CCCAGGACAGAATTCCTGGGCCA No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data
991570672_991570686 30 Left 991570672 5:68050228-68050250 CCCAGGACAGAATTCCTGGGCCA No data
Right 991570686 5:68050281-68050303 CAGATTGCCCAGGCATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991570672 Original CRISPR TGGCCCAGGAATTCTGTCCT GGG (reversed) Intergenic