ID: 991570673

View in Genome Browser
Species Human (GRCh38)
Location 5:68050229-68050251
Sequence CTGGCCCAGGAATTCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991570673_991570681 2 Left 991570673 5:68050229-68050251 CCAGGACAGAATTCCTGGGCCAG No data
Right 991570681 5:68050254-68050276 GAAATCTGGAAGAACTCCACGGG No data
991570673_991570680 1 Left 991570673 5:68050229-68050251 CCAGGACAGAATTCCTGGGCCAG No data
Right 991570680 5:68050253-68050275 GGAAATCTGGAAGAACTCCACGG No data
991570673_991570683 19 Left 991570673 5:68050229-68050251 CCAGGACAGAATTCCTGGGCCAG No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data
991570673_991570686 29 Left 991570673 5:68050229-68050251 CCAGGACAGAATTCCTGGGCCAG No data
Right 991570686 5:68050281-68050303 CAGATTGCCCAGGCATCAGAGGG No data
991570673_991570685 28 Left 991570673 5:68050229-68050251 CCAGGACAGAATTCCTGGGCCAG No data
Right 991570685 5:68050280-68050302 CCAGATTGCCCAGGCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991570673 Original CRISPR CTGGCCCAGGAATTCTGTCC TGG (reversed) Intergenic