ID: 991570678

View in Genome Browser
Species Human (GRCh38)
Location 5:68050242-68050264
Sequence TTCCAGATTTCCCCTGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991570678_991570685 15 Left 991570678 5:68050242-68050264 CCTGGGCCAGGGGAAATCTGGAA No data
Right 991570685 5:68050280-68050302 CCAGATTGCCCAGGCATCAGAGG No data
991570678_991570686 16 Left 991570678 5:68050242-68050264 CCTGGGCCAGGGGAAATCTGGAA No data
Right 991570686 5:68050281-68050303 CAGATTGCCCAGGCATCAGAGGG No data
991570678_991570683 6 Left 991570678 5:68050242-68050264 CCTGGGCCAGGGGAAATCTGGAA No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991570678 Original CRISPR TTCCAGATTTCCCCTGGCCC AGG (reversed) Intergenic