ID: 991570679

View in Genome Browser
Species Human (GRCh38)
Location 5:68050248-68050270
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991570679_991570685 9 Left 991570679 5:68050248-68050270 CCAGGGGAAATCTGGAAGAACTC No data
Right 991570685 5:68050280-68050302 CCAGATTGCCCAGGCATCAGAGG No data
991570679_991570686 10 Left 991570679 5:68050248-68050270 CCAGGGGAAATCTGGAAGAACTC No data
Right 991570686 5:68050281-68050303 CAGATTGCCCAGGCATCAGAGGG No data
991570679_991570683 0 Left 991570679 5:68050248-68050270 CCAGGGGAAATCTGGAAGAACTC No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991570679 Original CRISPR GAGTTCTTCCAGATTTCCCC TGG (reversed) Intergenic