ID: 991570683

View in Genome Browser
Species Human (GRCh38)
Location 5:68050271-68050293
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991570678_991570683 6 Left 991570678 5:68050242-68050264 CCTGGGCCAGGGGAAATCTGGAA No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data
991570673_991570683 19 Left 991570673 5:68050229-68050251 CCAGGACAGAATTCCTGGGCCAG No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data
991570668_991570683 28 Left 991570668 5:68050220-68050242 CCCTATAGCCCAGGACAGAATTC No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data
991570672_991570683 20 Left 991570672 5:68050228-68050250 CCCAGGACAGAATTCCTGGGCCA No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data
991570679_991570683 0 Left 991570679 5:68050248-68050270 CCAGGGGAAATCTGGAAGAACTC No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data
991570669_991570683 27 Left 991570669 5:68050221-68050243 CCTATAGCCCAGGACAGAATTCC No data
Right 991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type