ID: 991570685

View in Genome Browser
Species Human (GRCh38)
Location 5:68050280-68050302
Sequence CCAGATTGCCCAGGCATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991570673_991570685 28 Left 991570673 5:68050229-68050251 CCAGGACAGAATTCCTGGGCCAG No data
Right 991570685 5:68050280-68050302 CCAGATTGCCCAGGCATCAGAGG No data
991570678_991570685 15 Left 991570678 5:68050242-68050264 CCTGGGCCAGGGGAAATCTGGAA No data
Right 991570685 5:68050280-68050302 CCAGATTGCCCAGGCATCAGAGG No data
991570672_991570685 29 Left 991570672 5:68050228-68050250 CCCAGGACAGAATTCCTGGGCCA No data
Right 991570685 5:68050280-68050302 CCAGATTGCCCAGGCATCAGAGG No data
991570679_991570685 9 Left 991570679 5:68050248-68050270 CCAGGGGAAATCTGGAAGAACTC No data
Right 991570685 5:68050280-68050302 CCAGATTGCCCAGGCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991570685 Original CRISPR CCAGATTGCCCAGGCATCAG AGG Intergenic