ID: 991570686

View in Genome Browser
Species Human (GRCh38)
Location 5:68050281-68050303
Sequence CAGATTGCCCAGGCATCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991570673_991570686 29 Left 991570673 5:68050229-68050251 CCAGGACAGAATTCCTGGGCCAG No data
Right 991570686 5:68050281-68050303 CAGATTGCCCAGGCATCAGAGGG No data
991570672_991570686 30 Left 991570672 5:68050228-68050250 CCCAGGACAGAATTCCTGGGCCA No data
Right 991570686 5:68050281-68050303 CAGATTGCCCAGGCATCAGAGGG No data
991570679_991570686 10 Left 991570679 5:68050248-68050270 CCAGGGGAAATCTGGAAGAACTC No data
Right 991570686 5:68050281-68050303 CAGATTGCCCAGGCATCAGAGGG No data
991570678_991570686 16 Left 991570678 5:68050242-68050264 CCTGGGCCAGGGGAAATCTGGAA No data
Right 991570686 5:68050281-68050303 CAGATTGCCCAGGCATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991570686 Original CRISPR CAGATTGCCCAGGCATCAGA GGG Intergenic