ID: 991573240

View in Genome Browser
Species Human (GRCh38)
Location 5:68077293-68077315
Sequence TGCAAATAGACTTGGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991573237_991573240 20 Left 991573237 5:68077250-68077272 CCAGCTACAGGAGATACAAAGAT No data
Right 991573240 5:68077293-68077315 TGCAAATAGACTTGGTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991573240 Original CRISPR TGCAAATAGACTTGGTGGAC AGG Intergenic
No off target data available for this crispr