ID: 991577710

View in Genome Browser
Species Human (GRCh38)
Location 5:68122323-68122345
Sequence TCTCCAGAAGGGTGGCCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991577704_991577710 -3 Left 991577704 5:68122303-68122325 CCATGCCTAACCAGCAAAGATCT No data
Right 991577710 5:68122323-68122345 TCTCCAGAAGGGTGGCCCTATGG No data
991577700_991577710 25 Left 991577700 5:68122275-68122297 CCTGCACCATAGCTTCTATGCTG No data
Right 991577710 5:68122323-68122345 TCTCCAGAAGGGTGGCCCTATGG No data
991577703_991577710 19 Left 991577703 5:68122281-68122303 CCATAGCTTCTATGCTGGTGGAC No data
Right 991577710 5:68122323-68122345 TCTCCAGAAGGGTGGCCCTATGG No data
991577705_991577710 -8 Left 991577705 5:68122308-68122330 CCTAACCAGCAAAGATCTCCAGA No data
Right 991577710 5:68122323-68122345 TCTCCAGAAGGGTGGCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991577710 Original CRISPR TCTCCAGAAGGGTGGCCCTA TGG Intergenic
No off target data available for this crispr