ID: 991578669

View in Genome Browser
Species Human (GRCh38)
Location 5:68131514-68131536
Sequence CAGAGATACCTGAATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991578669_991578671 3 Left 991578669 5:68131514-68131536 CCTACCTCATTCAGGTATCTCTG No data
Right 991578671 5:68131540-68131562 ATTAAATAATAGACATGTGAAGG No data
991578669_991578672 20 Left 991578669 5:68131514-68131536 CCTACCTCATTCAGGTATCTCTG No data
Right 991578672 5:68131557-68131579 TGAAGGATATATCTATTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991578669 Original CRISPR CAGAGATACCTGAATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr