ID: 991582604

View in Genome Browser
Species Human (GRCh38)
Location 5:68172571-68172593
Sequence CTGGTGGTGGGGCCTTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991582592_991582604 18 Left 991582592 5:68172530-68172552 CCCATTTGGTGTCCTGGGTGGAA No data
Right 991582604 5:68172571-68172593 CTGGTGGTGGGGCCTTTGTCTGG No data
991582598_991582604 6 Left 991582598 5:68172542-68172564 CCTGGGTGGAAAGGGCAGGGCTC No data
Right 991582604 5:68172571-68172593 CTGGTGGTGGGGCCTTTGTCTGG No data
991582593_991582604 17 Left 991582593 5:68172531-68172553 CCATTTGGTGTCCTGGGTGGAAA No data
Right 991582604 5:68172571-68172593 CTGGTGGTGGGGCCTTTGTCTGG No data
991582588_991582604 25 Left 991582588 5:68172523-68172545 CCAGCATCCCATTTGGTGTCCTG No data
Right 991582604 5:68172571-68172593 CTGGTGGTGGGGCCTTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991582604 Original CRISPR CTGGTGGTGGGGCCTTTGTC TGG Intergenic
No off target data available for this crispr