ID: 991583197

View in Genome Browser
Species Human (GRCh38)
Location 5:68177796-68177818
Sequence GCTGATGGGGAAGAATGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991583191_991583197 23 Left 991583191 5:68177750-68177772 CCTAGTGGCAGGATAGAGTTAGG No data
Right 991583197 5:68177796-68177818 GCTGATGGGGAAGAATGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991583197 Original CRISPR GCTGATGGGGAAGAATGAGT AGG Intergenic
No off target data available for this crispr