ID: 991588563

View in Genome Browser
Species Human (GRCh38)
Location 5:68224916-68224938
Sequence CTATAAAGACAGCTTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991588563 Original CRISPR CTATAAAGACAGCTTGATGG AGG (reversed) Intronic
900373555 1:2343320-2343342 CTACACAGACAGCTTTGTGGGGG - Intronic
908025247 1:59943888-59943910 CTAGAAAGGAAGCTTGATTGTGG + Intergenic
908732951 1:67245650-67245672 GAATAAAGCCAGCTTGATTGTGG + Intronic
909284888 1:73803446-73803468 CTATACAGACAGCATAATGGGGG - Intergenic
909485787 1:76172138-76172160 CGATAAAGCCAACTTGATCGTGG - Intronic
910135997 1:83970829-83970851 TGATAATGACAGCTTCATGGTGG + Intronic
910996524 1:93110304-93110326 CTGTAAAGACAGCTTGGTCAAGG - Exonic
912582686 1:110734709-110734731 CGCTAAAGACAGCTGGAAGGAGG - Intergenic
913553495 1:119939677-119939699 CAATATAGACAGTTTGCTGGAGG + Intronic
914926872 1:151896336-151896358 CTATACAGGAAGCATGATGGTGG - Intronic
915399879 1:155614306-155614328 CAATAAAAACAGCTGGATGCAGG + Exonic
915417037 1:155750170-155750192 CAATAAAAACAGCTGGATGCAGG + Exonic
919062871 1:192656392-192656414 CTAAAGAGACAGCTGAATGGTGG - Intronic
920254329 1:204644247-204644269 CTGTAAGGAGAGCTTCATGGAGG - Intronic
922676304 1:227553656-227553678 GTATGAAGCCAGCTTGATTGTGG - Intergenic
924584917 1:245353715-245353737 CTTTAAATACAGCAGGATGGTGG - Intronic
1064499567 10:15955204-15955226 CTAATAAAAGAGCTTGATGGAGG - Intergenic
1064620308 10:17208879-17208901 CTGCAAAGACAGCTTGATACAGG + Intergenic
1065253376 10:23839802-23839824 CTACAAAGACAGATTTGTGGTGG - Intronic
1070043520 10:72806467-72806489 CTTTAAAGACAGCTATGTGGAGG + Intronic
1071226949 10:83541528-83541550 CTAAACAGACAGCTTCCTGGAGG - Intergenic
1076813878 10:132904717-132904739 CTACAAAGACAGCGTCATAGAGG - Intronic
1079533315 11:21481244-21481266 CTACAAAGACAGCTTCATAAAGG + Intronic
1081436647 11:43034266-43034288 CAATAAAAACAGGTTGGTGGGGG + Intergenic
1081602659 11:44506095-44506117 CTATACAGAAAACATGATGGTGG - Intergenic
1082707375 11:56509083-56509105 CGATAAAGCCAACTTGATCGTGG - Intergenic
1082921479 11:58499443-58499465 CTATACAGAGAGATTCATGGAGG - Intergenic
1085828022 11:79868497-79868519 GTATAAAGCCAACTTGATCGTGG - Intergenic
1088789903 11:113215184-113215206 CAATAAAGATAGCTTTCTGGTGG - Intronic
1090420820 11:126573717-126573739 CTATCCAGAGAGCTAGATGGAGG + Intronic
1090488918 11:127140635-127140657 ACAGAAAGACAGCTTCATGGTGG + Intergenic
1091809937 12:3388704-3388726 CTTTAGAGACAGCCTGATGTGGG - Intronic
1093174524 12:15897652-15897674 ATACAAAGACATCTTGATGGAGG - Intronic
1093186396 12:16023771-16023793 CTATAAAGACTGTTTGAGGCCGG - Intronic
1097464455 12:59905281-59905303 CTATACTGACAGCTTGAAGAAGG - Intergenic
1098741439 12:74178376-74178398 CTATAAAGAGAACACGATGGGGG + Intergenic
1101347393 12:103899024-103899046 CTATAAATATAGGTTGATGTGGG - Intergenic
1102978567 12:117224091-117224113 CTAGAATGACAGTTTCATGGGGG + Intronic
1103265657 12:119628129-119628151 ATATAAAAGCAGCTTGATTGAGG - Intronic
1104357635 12:128101709-128101731 CTAGAGAGACAGCTGGGTGGAGG - Intergenic
1105538113 13:21288655-21288677 CAATAAAAACAGCATGATGCTGG - Intergenic
1107155260 13:37158914-37158936 GGATAAAGACTGCTTGATTGTGG + Intergenic
1107872510 13:44760265-44760287 CAAGAAAGACAGCTTGCTGTGGG - Intergenic
1109702548 13:66046532-66046554 TTATAAAGACTGCTTGAGTGTGG + Intergenic
1110230940 13:73166483-73166505 CTGTCAAGACAGCTAGTTGGAGG - Intergenic
1111544094 13:89707305-89707327 CTTTACAGAGAGCATGATGGTGG - Intergenic
1112747213 13:102540158-102540180 CTATTAAGACAGCATGATACTGG - Intergenic
1114138986 14:19889991-19890013 CTGTACAGACAGCATGATGCTGG + Intergenic
1116854912 14:49943705-49943727 TTGTAAAGACAGTTTGATGACGG + Intergenic
1118166827 14:63344884-63344906 CCATAAAGCCAGCTTCATGAAGG + Intergenic
1119596534 14:75939865-75939887 TTCAAAAGACAGATTGATGGTGG - Intronic
1120194315 14:81465934-81465956 CTAGAAAAACAGCTTCAAGGAGG - Intergenic
1120799525 14:88673186-88673208 GGATGAAGACAGCTTGATCGTGG - Intronic
1125858167 15:42971327-42971349 CCTTAAAGATAGGTTGATGGAGG - Intronic
1126203989 15:46020979-46021001 CTGTAAAGAAAGCATGATGCTGG - Intergenic
1129483866 15:75849602-75849624 CCATTAAGACAGTTTTATGGTGG + Intronic
1131539276 15:93262429-93262451 CTATTAAGAGGGCTTGGTGGGGG + Intergenic
1132632748 16:927765-927787 CTTTAAAAACAGCTTAATGAGGG - Intronic
1134217472 16:12327218-12327240 CTAGAAAGGAAGCTTTATGGGGG - Intronic
1134912123 16:18036973-18036995 TTATAAAGACAGATTGAAAGAGG + Intergenic
1135794249 16:25426139-25426161 CTATGAAGTCAGGTTGATGTAGG - Intergenic
1143004011 17:3815213-3815235 TTAGAAAGACAACTTGAGGGTGG - Intronic
1143234422 17:5386628-5386650 CTATTAAGACAGGTTGATTCTGG + Intronic
1149717611 17:58808620-58808642 CTAAAAAAACAGCTTTATTGAGG + Intronic
1150306134 17:64087103-64087125 CTACAAAGCCAGCTTCCTGGGGG - Intronic
1156026326 18:32658999-32659021 GTATGAAGCCAGCTTGATTGTGG - Intergenic
1156427376 18:37028861-37028883 TAATAAAGCCAGCTTGATTGTGG + Intronic
1156580083 18:38364587-38364609 CAATAAAGATACATTGATGGAGG - Intergenic
1158393214 18:57060300-57060322 CTATACACACAGACTGATGGAGG + Intergenic
1158635399 18:59151767-59151789 CTAGAAATACAGCTTGACGGGGG - Intronic
1166064153 19:40347021-40347043 GTATAAGGACAACTTAATGGGGG + Intronic
926753582 2:16218901-16218923 CTAGAGAGAAAACTTGATGGGGG - Intergenic
927866567 2:26591703-26591725 CATAAAAGACAGCGTGATGGTGG - Intronic
928126996 2:28623751-28623773 CTTTAAACACAGCTTTATTGAGG + Intronic
928350117 2:30543861-30543883 CTAAAAACACAGATTGATGAGGG - Intronic
928763448 2:34611830-34611852 CAATAATGACATCTTGGTGGAGG + Intergenic
928923944 2:36556962-36556984 CTATAAAGACATCTCGATGCTGG + Intronic
931581265 2:63777932-63777954 TTTTAAAGACAGCTTTATTGAGG - Intronic
934872154 2:97876500-97876522 GGATAAAGACAACTTGATCGTGG - Intronic
935228541 2:101076318-101076340 CTTTGACGAAAGCTTGATGGGGG + Intronic
936022750 2:109007275-109007297 CTAGAAAGAGAGCTAGCTGGTGG - Intergenic
937615555 2:123917851-123917873 AAATAAATACAGCTGGATGGTGG - Intergenic
939904899 2:147900376-147900398 CTACAAAAACATCTTTATGGAGG - Intronic
942995485 2:182255178-182255200 CTATAAACACAGGTTGATCTAGG - Intronic
945326557 2:208488942-208488964 CAGTAAAGACAGCGTGCTGGAGG - Intronic
946051930 2:216870145-216870167 CTAGAAAGAGATCTTGAGGGAGG - Intergenic
946541056 2:220685068-220685090 CCAGAAAGAAAGGTTGATGGTGG - Intergenic
947085292 2:226444509-226444531 CTATAAAGACACCAAGATAGAGG + Intergenic
947113709 2:226747227-226747249 CTATAAATACTTCTTAATGGCGG - Intronic
947643054 2:231717841-231717863 GAACAAAGACAGCTTGCTGGTGG + Intergenic
1169897442 20:10519187-10519209 TTTTAAAAACAGCTTTATGGAGG + Intronic
1170758765 20:19230608-19230630 ATAGAAAGACATATTGATGGGGG + Intronic
1170758774 20:19230644-19230666 ATAGAAAGACATATTGATGGGGG + Intronic
1174927989 20:54782493-54782515 GAATAAAGACAGTTTGAGGGGGG + Intergenic
1175472109 20:59237722-59237744 CAATAAAGACATCTTCATGGGGG - Intronic
1182189543 22:28444193-28444215 CTATCAAAACAGCTTTATGGTGG - Intronic
1183021131 22:35027292-35027314 GTATAAAGCCAACTTGATTGTGG + Intergenic
1185217773 22:49612605-49612627 CAATAAAGACAGTGTGATAGTGG - Intronic
951333034 3:21387993-21388015 CTAAAAAAACTGCTTGATGCAGG - Intergenic
952062327 3:29525459-29525481 CTGTGCAAACAGCTTGATGGAGG - Intronic
952666688 3:35914655-35914677 CTATCAAGACAGTGTGATGTTGG - Intergenic
952667902 3:35929533-35929555 GTATAAATACAGCTAGATGTAGG - Intergenic
953725512 3:45394496-45394518 CTGAAAAGACAGCTAAATGGTGG + Exonic
954684510 3:52363107-52363129 CTCAGAAGACAGCTTGAAGGTGG - Exonic
958516878 3:95127485-95127507 CTAGAAAGAACGCTGGATGGAGG - Intergenic
958533283 3:95363672-95363694 CTATAAAGACAGTATGATAATGG - Intergenic
960792542 3:121449703-121449725 CTATAAAGACTGCTGGATAAAGG - Intronic
961989813 3:131176371-131176393 TTATAAAGATAAATTGATGGTGG + Intronic
962651137 3:137493079-137493101 CTATATAGAAATGTTGATGGGGG - Intergenic
963218055 3:142773418-142773440 CTAAAAGGACAGCATGATTGCGG + Intronic
965510062 3:169558363-169558385 CTAGAAAAACAGCAGGATGGAGG - Intronic
970014052 4:11492937-11492959 ATATGAAGAAAGCTTGATGGAGG - Intergenic
970780969 4:19737051-19737073 TTATAAAGACAGCTTTGCGGAGG - Intergenic
971977513 4:33710023-33710045 CCATAAAAGCAGCTTGGTGGGGG - Intergenic
974355127 4:60802650-60802672 TTAGAAAGACAGGTTGAGGGAGG - Intergenic
975514038 4:75225151-75225173 ATATAAAGCCAACTTGATTGTGG - Intergenic
975718734 4:77229912-77229934 ACATAAAGACAGCATAATGGAGG + Intronic
977790646 4:101097433-101097455 CTAGATAGAAAGCTTAATGGTGG + Intronic
979830216 4:125290735-125290757 CAATAAAGACTGCTTGATTTTGG + Intergenic
981402149 4:144325945-144325967 TGATAAAGACTGCTTGATTGTGG - Intergenic
982903150 4:161032830-161032852 ATATAGAGATATCTTGATGGTGG + Intergenic
985039638 4:185877124-185877146 CTTTAAAAATAGCTTGCTGGAGG + Intronic
989332428 5:40275533-40275555 CTTTGCTGACAGCTTGATGGTGG - Intergenic
990787417 5:59438037-59438059 CTATCACGACAGCTGCATGGGGG + Intronic
991535107 5:67661320-67661342 CTATAAAGACACGTTTATTGCGG - Intergenic
991588563 5:68224916-68224938 CTATAAAGACAGCTTGATGGAGG - Intronic
994035056 5:95189339-95189361 ATATAAAGACATCTTGATTAAGG + Intronic
995402311 5:111757215-111757237 CTAGAAAGACAGATTGGGGGGGG + Intronic
997610819 5:135214287-135214309 CTATAAAGACAACTTTCTGCAGG - Intronic
998723801 5:144985779-144985801 GTATAAAGCCAACTTGATCGTGG + Intergenic
999939823 5:156530223-156530245 CTATCTACACAGCTTGGTGGTGG - Intronic
1000557308 5:162741845-162741867 GGATGAAGACAGCTTGATCGTGG + Intergenic
1002981961 6:2146684-2146706 CTATAAAGACATTTTGAGAGGGG - Intronic
1003130623 6:3392421-3392443 CTATATAGACAGATCGATGCAGG + Intronic
1005086445 6:22012087-22012109 CGTTAAAGAGAGCCTGATGGAGG + Intergenic
1008001056 6:46360230-46360252 GTTTAAAGAGAGCTTGATGTAGG + Intronic
1008186956 6:48405119-48405141 ATATGAAGACAGCTTGATTGTGG - Intergenic
1010527894 6:76925499-76925521 CTATACAGAAAGCATGATGCTGG - Intergenic
1014106193 6:117564261-117564283 TCTTACAGACAGCTTGATGGTGG - Intronic
1016497352 6:144679099-144679121 CTATAAATACATCTTGAATGAGG - Intronic
1017667516 6:156735455-156735477 AAAGAAAGACAGCTTGATGAGGG + Intergenic
1018528412 6:164737586-164737608 CTAGGAAGACAGATTTATGGAGG - Intergenic
1019474825 7:1238963-1238985 CTTTAAATACAGTTTAATGGGGG - Intergenic
1020122186 7:5510927-5510949 CTATAATGACAACTTGAAAGTGG + Intronic
1021347324 7:19544604-19544626 GTATGAAGCCAACTTGATGGTGG + Intergenic
1021349290 7:19569999-19570021 ATATAAAGAGAACTTGTTGGTGG - Intergenic
1021909777 7:25373161-25373183 CTTTTAAAACAGCTTTATGGAGG + Intergenic
1022152749 7:27625773-27625795 CTATAAATATAGCGTGATGTGGG + Intronic
1024729714 7:52240673-52240695 CTATAAAGCCAGAATGTTGGAGG - Intergenic
1025986910 7:66461934-66461956 TTAAAAAGACAGCTTTATTGAGG - Intergenic
1026001645 7:66563557-66563579 ATTAAAAGACAGTTTGATGGTGG - Intergenic
1026028109 7:66763508-66763530 TTAAAAAGACAGCTTTATTGAGG + Intronic
1027650369 7:80859711-80859733 CTCAAAAGACAGCTAAATGGAGG - Intronic
1030490436 7:110226106-110226128 CTATACAGACAGCTGGATGGTGG + Intergenic
1032802809 7:135330069-135330091 ACATAAAGACAGCTGGATGTTGG + Intergenic
1033679213 7:143576922-143576944 GGATAAAGCCAACTTGATGGTGG + Intergenic
1033692624 7:143752528-143752550 GGATAAAGCCAACTTGATGGTGG - Intergenic
1033967988 7:147001519-147001541 CTATAAAGAAGGCTTGGTGCTGG + Intronic
1034905155 7:154937977-154937999 CAATCAAGACAGCATGATGTTGG - Intronic
1035960704 8:4134315-4134337 CTATAAAGACATCTTTAAGGTGG + Intronic
1038805203 8:30784111-30784133 TTTTAAAGACAGCTTCATTGAGG + Intronic
1038998268 8:32950503-32950525 CTATACAGAAAGCATGATGCTGG + Intergenic
1039138778 8:34358762-34358784 CTATAATAACTTCTTGATGGGGG + Intergenic
1039226368 8:35392718-35392740 GGATAAAGACAACTTGGTGGGGG + Intronic
1039545573 8:38408536-38408558 CTAAAAAAACAACATGATGGGGG - Exonic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040978333 8:53218784-53218806 CTAAAAAGACAGCCTAGTGGTGG - Intergenic
1041494472 8:58470065-58470087 CTATGAAGGCAGCTGGAAGGGGG + Intergenic
1042631354 8:70820556-70820578 CTATAAAGACTGCTTGAGGCTGG + Intergenic
1044331436 8:90924532-90924554 CTATAAAGAAATCTTGTTGGAGG + Intronic
1046641448 8:116736291-116736313 CTATTAATACATCTTGATTGTGG + Intronic
1048878451 8:138854756-138854778 TCATAGAGACAGCTTGATAGAGG + Intronic
1048884731 8:138900805-138900827 CTAGAAAGTAAGCTGGATGGAGG - Intronic
1050059171 9:1687515-1687537 TTAAAGGGACAGCTTGATGGTGG - Intergenic
1050494824 9:6229864-6229886 CAATAAAGTCGGCTTGATTGTGG + Intronic
1056197743 9:84245120-84245142 TTACAAAGACAGCTTGAGAGGGG + Intergenic
1056484764 9:87044374-87044396 CTATTAGGACAGCTTGGTGCAGG - Intergenic
1056527115 9:87454045-87454067 CTATACAGAAAGCATGATGCTGG + Intergenic
1056747255 9:89313583-89313605 TTATAAAGAAACCCTGATGGAGG + Intronic
1057218665 9:93243855-93243877 CAATGAAAACAGCTTGATGTTGG + Intronic
1057583531 9:96308953-96308975 TTAAAAAAACAGCTTGATCGAGG - Intergenic
1057787648 9:98099160-98099182 CTATAAAGGCAGGCTGATTGCGG + Intronic
1059780149 9:117517718-117517740 CTATAAAGACTGCTAGCTGTTGG + Intergenic
1060768316 9:126311588-126311610 CTATACAGAAAGCGTGATGCTGG + Intergenic
1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG + Intergenic
1189059034 X:37732660-37732682 CTTTAAAAACAGCTTTATTGAGG + Intronic
1189431744 X:40953115-40953137 CTATAAAGCAACCTTGATGACGG + Intergenic
1190166264 X:48075242-48075264 CAATATAGACACATTGATGGTGG + Intergenic
1190593398 X:52027966-52027988 GTATAAAGCCAACTTGATTGTGG + Intergenic
1191893894 X:65972898-65972920 CAAGAAAGACATCTTGAAGGAGG + Intergenic
1192001454 X:67156241-67156263 CTGTACAGAAAGCATGATGGTGG - Intergenic
1194356589 X:92892655-92892677 GAATAAAGCCTGCTTGATGGTGG + Intergenic
1197207445 X:123801997-123802019 CTATAAAGCCAGCCTGCTTGGGG - Intergenic
1198179850 X:134195637-134195659 CTTTAAAAACAGCTTTATTGAGG + Intergenic
1198728828 X:139705330-139705352 AAATAAAGACAGCTTGGTAGTGG + Intronic
1198884460 X:141319131-141319153 CCATAAACACAGCTTTATGTGGG - Intergenic
1199272997 X:145907327-145907349 CTATCATTACAGCTGGATGGTGG - Intergenic
1200257847 X:154594289-154594311 CTATACAGAAAGCATGGTGGTGG - Intergenic
1200277013 X:154743035-154743057 TTTTAAAGACAGCTTTATTGAGG - Intronic
1200664923 Y:6009655-6009677 GAATAAAGCCTGCTTGATGGTGG + Intergenic
1202245473 Y:22815870-22815892 ATGTAAAGACAGTTTGATGGTGG - Intergenic
1202398462 Y:24449618-24449640 ATGTAAAGACAGTTTGATGGTGG - Intergenic
1202472319 Y:25220468-25220490 ATGTAAAGACAGTTTGATGGTGG + Intergenic