ID: 991589011

View in Genome Browser
Species Human (GRCh38)
Location 5:68229596-68229618
Sequence CAGGGTAGACAGAGGGTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991589008_991589011 -7 Left 991589008 5:68229580-68229602 CCTCGTTAATGGGCAGCAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG 0: 1
1: 0
2: 0
3: 27
4: 332
991589001_991589011 26 Left 991589001 5:68229547-68229569 CCACATGCAGTTTTGTTTTGTGG 0: 1
1: 0
2: 2
3: 36
4: 343
Right 991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG 0: 1
1: 0
2: 0
3: 27
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991589011 Original CRISPR CAGGGTAGACAGAGGGTGCG AGG Intronic
900188841 1:1344938-1344960 CAGGTGAGTCAGAGGGTGCTGGG - Intronic
900425452 1:2576324-2576346 CAGGGCAGAGAGAGGGCGCTTGG + Intergenic
900427747 1:2588165-2588187 GAGGGTCCACAGAGGGTGCAGGG - Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
903269353 1:22178018-22178040 CTGGGCAGGCAGGGGGTGCGGGG - Intergenic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
904913552 1:33953400-33953422 CAGGACAGACAGACTGTGCGAGG - Intronic
905500385 1:38431975-38431997 TAGGGAAGATAGAGGGTGGGAGG + Intergenic
906108274 1:43307413-43307435 CAGGCTAGAAAGAGAGTGTGTGG - Exonic
906547018 1:46626973-46626995 CAGGTGAGCCAGAGGGTGAGGGG + Intergenic
907308835 1:53528020-53528042 GAGGGTAGGGAGAGGGTGCAGGG + Intronic
909467756 1:75992376-75992398 CAGGGTAGAGACAGGTTGAGCGG - Intergenic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
911000549 1:93160822-93160844 CAGGGGAGGCAGGGGGGGCGGGG - Intronic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
913275558 1:117134571-117134593 ATGGGTAGAGAGAGGGTGTGGGG - Intergenic
915321141 1:155057113-155057135 CAGGATGGAGAGAGGGTGTGGGG + Intronic
915934936 1:160084906-160084928 CGGGGTTGGCAGAGGGTGGGCGG + Intronic
917401464 1:174653588-174653610 CTGGTTAGACAGTGGGTACGGGG - Intronic
917599086 1:176557301-176557323 CGGGTTAGACATAGGGAGCGAGG + Intronic
920288643 1:204900662-204900684 CAGGGGAGACAGGGAGTGCTGGG + Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922920817 1:229301319-229301341 CAGGGAAGAAGGAGGGTGCTAGG + Intronic
924189778 1:241538349-241538371 CAAGGTAGAAAGAGGGTTGGTGG + Intronic
924462122 1:244269061-244269083 CAGGGAAGACGCAGGGTGTGAGG - Intergenic
1064031069 10:11883241-11883263 CAGGGTAGAAAAAGGATGCCTGG - Intergenic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1066351688 10:34642208-34642230 AAGGGATGACAGAGGGTGCGAGG - Intronic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1072567722 10:96631292-96631314 CAGGGTTGACAGATTGTGTGAGG - Intronic
1076752552 10:132550894-132550916 CAGGGTGGTCATTGGGTGCGTGG + Intronic
1077159547 11:1106443-1106465 GATGGTAGACAGATGGTGGGTGG - Intergenic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1080281736 11:30565101-30565123 CAGGGGAGACACAGGCTGCACGG - Intronic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080394344 11:31876079-31876101 CAGGGGAGGCCGAGAGTGCGAGG - Intronic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1080765149 11:35289164-35289186 CAGGGAGGACAGAGGGAGTGGGG - Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1083878559 11:65537327-65537349 CAGGCTAGGCAGATGGTGCCTGG + Intronic
1084360670 11:68666987-68667009 CAGGGAAGACAAGGAGTGCGGGG + Intergenic
1084900660 11:72307666-72307688 CATGGCAGATAGAGGGTGGGAGG + Intronic
1084960233 11:72712635-72712657 CTGTGTGGACAGAGGGGGCGTGG - Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1087973379 11:104513633-104513655 CAGGCAAGAGAGAGTGTGCGTGG + Intergenic
1088520443 11:110692480-110692502 CAAAGCAGACAGAGGGTGTGAGG - Intronic
1089332859 11:117701924-117701946 CAGGGTAAACAGACAGCGCGTGG + Intronic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1091601843 12:1922541-1922563 CGGGGGAGGCAGAGGGTGAGTGG - Intergenic
1091718211 12:2794880-2794902 GAGCGCAGACAGAGGGGGCGGGG - Intergenic
1094063498 12:26340087-26340109 GAGGGGAGACAGAGGGTCCAGGG - Intronic
1095558538 12:43537660-43537682 AAGGATAGAGAGAGGGTGTGTGG - Intronic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1096808889 12:54157340-54157362 CAGGGTACACAGACTGTGTGGGG - Intergenic
1096978933 12:55717371-55717393 CAGGCTTGCCAGAGGGTGGGAGG - Intronic
1098141062 12:67450670-67450692 CAAGAGAGAGAGAGGGTGCGGGG - Intergenic
1098351358 12:69564536-69564558 CATGGCAGACAAAGGGTGCCAGG - Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1099789687 12:87317320-87317342 CTCTGTAGGCAGAGGGTGCGGGG + Intergenic
1099914471 12:88874844-88874866 CAGGGGAGACAGAGCGTGTGGGG + Intergenic
1101760172 12:107651866-107651888 CAGGGCAGAGAGTGGGTGCTGGG + Intronic
1102703647 12:114862422-114862444 CAGGGTAGAGAAAGGCTGCATGG + Intergenic
1104807903 12:131601128-131601150 CAGGGAAGACAGTGTGTGCAGGG + Intergenic
1104940543 12:132392543-132392565 CAGGGTGGCCGGAGGGTCCGGGG - Intergenic
1104951799 12:132444470-132444492 CAGGGGAGACAGAGGGCTCCGGG - Intergenic
1104962221 12:132493702-132493724 CAGGGTACACAAAGGGGGCGGGG - Intronic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106728865 13:32517848-32517870 CAGGGGAGACAGAGGTGGGGAGG - Exonic
1111394437 13:87646739-87646761 CAGGGAAGACAGTGGGTGAAGGG + Intergenic
1111448326 13:88379948-88379970 AAGGGTGGATAGAGGGTGGGAGG - Intergenic
1111647483 13:91049137-91049159 CAGGGGAGACAGAGAGCGAGGGG + Intergenic
1117990282 14:61425941-61425963 CAGGTGAGACAGAGAGTGTGTGG - Intronic
1118758184 14:68860727-68860749 CAGGGTTGTCAGAGGGTCCCAGG - Intergenic
1120746255 14:88154584-88154606 CAGGGTAGACACATGGGGCGGGG + Intergenic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1122857690 14:104567771-104567793 CAGGGTCCAGAGAGGGTGCGTGG - Intronic
1125004664 15:34803590-34803612 GAGGGTAGAAAGAGGGTGATGGG + Intergenic
1125062072 15:35436997-35437019 CAGGGGAGACAGGGTGTACGTGG + Intronic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126098897 15:45107978-45108000 AAGGCTAGACAGAGGGTCTGGGG + Intronic
1126350777 15:47742825-47742847 CAGGAAACACAGAGGGTGTGGGG - Intronic
1126413575 15:48395912-48395934 AAGGGAAGAGAGAGGGTGTGGGG + Intergenic
1128813638 15:70589428-70589450 GAGGGCAGTCAGAGGGTGTGAGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130170682 15:81509818-81509840 CAAGTTAGACAGAGGGTGGGAGG - Intergenic
1130330220 15:82916641-82916663 CAGGGTCGGCAGAGGGGGAGAGG + Intronic
1132571332 16:645673-645695 CAGGGCAGATGGAGGGTGTGGGG + Intronic
1132997593 16:2831262-2831284 CAGAGGAGACAGAGTGTGGGCGG + Intronic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1136395332 16:29989411-29989433 CATGTTAGACAGAGGGGGTGGGG - Intronic
1136928556 16:34397313-34397335 CAGGGGAGACAGAGGCACCGAGG + Intergenic
1136934581 16:34448135-34448157 AAGGGTAGTGAGAGGGTGGGGGG + Intergenic
1136969991 16:34963679-34963701 AAGGGTAGTGAGAGGGTGGGGGG - Intergenic
1136976018 16:35014491-35014513 CAGGGGAGACAGAGGCACCGAGG - Intergenic
1137738382 16:50742028-50742050 CAGGGAAGAGGGAGGGAGCGGGG - Intronic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1140880136 16:79190506-79190528 CAGTGGAGCCAGAGGGTGTGAGG - Intronic
1141029463 16:80575042-80575064 CAAGGGAGACTGAGGGTGGGGGG + Intergenic
1141740297 16:85887197-85887219 CAAGGAAGACTGAGGGTGCCCGG + Intergenic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142150558 16:88510786-88510808 AAGGGTAGGCAGTGGGTGGGTGG - Intronic
1142492297 17:286903-286925 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492302 17:286931-286953 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492307 17:286959-286981 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492332 17:287091-287113 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492347 17:287169-287191 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492352 17:287197-287219 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492357 17:287225-287247 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492362 17:287253-287275 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492392 17:287413-287435 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492417 17:287545-287567 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492422 17:287571-287593 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492437 17:287649-287671 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492446 17:287705-287727 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492451 17:287733-287755 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492485 17:287971-287993 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492504 17:288077-288099 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492524 17:288183-288205 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492529 17:288209-288231 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492560 17:288369-288391 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492570 17:288421-288443 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492575 17:288449-288471 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492585 17:288501-288523 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492590 17:288529-288551 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492595 17:288557-288579 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492605 17:288611-288633 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492610 17:288639-288661 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492615 17:288667-288689 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492620 17:288695-288717 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492625 17:288723-288745 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492630 17:288751-288773 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492635 17:288777-288799 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492640 17:288803-288825 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492645 17:288829-288851 GACGGTGGAGAGAGGGTGCGAGG - Intronic
1142492650 17:288855-288877 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1143295569 17:5869135-5869157 CAGGGGAGATAGCTGGTGCGTGG + Intronic
1143898624 17:10156603-10156625 CACTGTAGCCAGAGGGTGCGAGG - Intronic
1145813958 17:27782142-27782164 CTGGGTAGACAGAGGCTTTGAGG + Intronic
1146521317 17:33527752-33527774 CAGGGTACAGAGAGGCTGTGTGG + Intronic
1147139689 17:38454072-38454094 CAGGGCAGCCAGAGGCAGCGCGG - Intronic
1147305742 17:39563279-39563301 CAGGGTAGGGAGTGGGTGAGTGG + Intronic
1147375159 17:40018742-40018764 CAGGCTAGTCAGAGTGTGGGTGG + Intergenic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1148076784 17:44941721-44941743 AAGGGAAGGCAGAGGGTGCCTGG + Intronic
1148155838 17:45424999-45425021 CAGGAGAGCCAGGGGGTGCGGGG + Intronic
1149608364 17:57940895-57940917 CAGGTTAGCCAGGGGCTGCGTGG - Intronic
1151464293 17:74274565-74274587 CAGGGTGTACAGAGGCTGCAGGG - Intronic
1151696728 17:75721709-75721731 CAGCGTGGACAGAGGGACCGGGG - Intronic
1152002640 17:77656004-77656026 CAGGCTGGACAGAGGCTGCAGGG + Intergenic
1152403559 17:80083534-80083556 CAGGGCAGACACAGGGCCCGAGG + Intronic
1153201750 18:2655120-2655142 CAGGGCCCCCAGAGGGTGCGGGG + Intergenic
1155733431 18:29191195-29191217 CAGGGTGGAAAGAGGGTGAAGGG - Intergenic
1157589002 18:48824991-48825013 CAGGGGAGAGAGAGGATGAGAGG - Intronic
1157665891 18:49486786-49486808 TAGTGGAGACAGAGGGAGCGGGG + Intronic
1157793624 18:50556151-50556173 TGGGTTAGACAGAGGATGCGGGG + Intergenic
1158599382 18:58844102-58844124 CAGGGTAGAGAAAGGATGCTGGG - Intergenic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1160462000 18:79046507-79046529 CAGGGCAGACAGAGTCTGAGTGG + Intergenic
1160787409 19:907437-907459 CGGGGAAGTCAGAGGGGGCGGGG + Intronic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161108020 19:2454215-2454237 CCCGGGAGGCAGAGGGTGCGGGG + Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161574809 19:5049380-5049402 CAGGGGAGACAGCTGGGGCGGGG + Intronic
1161790667 19:6357984-6358006 CAGGGCAGGCAGGGGGTGCAGGG + Intergenic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1162467028 19:10848579-10848601 CAAGGTGGACAGAGGATGGGGGG - Intronic
1162745184 19:12793895-12793917 CAGGTCAGACGGAGGGGGCGTGG - Intronic
1162826446 19:13255317-13255339 CGAGTTAGACAGAGGGTGCCCGG - Intronic
1164704788 19:30312279-30312301 CAGGATGAACAGAGGGGGCGGGG + Intronic
1165504212 19:36214614-36214636 CAGGGGAGGCAGAAGGTGAGGGG - Exonic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1167226184 19:48242246-48242268 CACGGTAGAAAGCGGGAGCGAGG - Intronic
1167538524 19:50070825-50070847 CAGGGGAGACAGGGAGTGTGGGG + Intergenic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1168188075 19:54714049-54714071 CAGGGTCCAGAGAGGGTGCTAGG - Intergenic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
925118370 2:1398863-1398885 CAGGACTGACAGAGGGTGGGGGG + Intronic
925852335 2:8094661-8094683 CAGGGTAGACAGTGTGGGCTTGG - Intergenic
926107402 2:10160850-10160872 CAGGGCAGACAGAGGTGGCCAGG - Intronic
929546113 2:42856189-42856211 CAGGGGAGCCACAGGGTGAGGGG + Intergenic
929679331 2:43973998-43974020 TTGGGTAGAAAGAGGATGCGGGG - Intronic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
938186059 2:129232987-129233009 CAGGGTAGGTAGTGGGTGTGGGG - Intergenic
938252663 2:129827684-129827706 CGGGAGAGGCAGAGGGTGCGCGG + Intergenic
938409002 2:131048430-131048452 AAGGGGAGACAGAGGATGAGCGG - Exonic
939671244 2:145015367-145015389 CAGGGTAGAGGGAGGGAGAGGGG - Intergenic
942044105 2:172089179-172089201 TTGGGTAGAAAGAGGGAGCGAGG + Exonic
946039936 2:216774773-216774795 CAGGGTAGACAGAGTATCCTGGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
947839290 2:233197471-233197493 CAGGGCAGAGAGATGGTGGGGGG - Intronic
948305416 2:236943799-236943821 CAGGGTAGACTGAGGATGGATGG + Intergenic
948789747 2:240371127-240371149 CATGGCTGACAGAGGGTGAGGGG + Intergenic
948791831 2:240383246-240383268 CAGGGCAGCCAGAGAGTGCGAGG + Intergenic
948880096 2:240852300-240852322 CAGGGTGGCCAAAGGGTGTGTGG - Intergenic
1169105083 20:2987733-2987755 CCAGGTAGAGAGAGGGTGAGTGG - Intronic
1169350430 20:4863919-4863941 CAGGCTAGACAGAAGCTGCTGGG - Intronic
1169841506 20:9943210-9943232 GAGGGTAGGCAGTGGCTGCGAGG - Intergenic
1171796322 20:29569287-29569309 CAGGGTAGACAGTGGGGTCTTGG + Intergenic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1172117432 20:32581319-32581341 CAGGGCAGAGAGAGGGCGAGGGG - Intronic
1173911566 20:46674561-46674583 CAGGGGAGACAGTGGGTAGGTGG + Intronic
1175059670 20:56230508-56230530 CAGGGAAGAAAGAGGGAGAGAGG + Intergenic
1175362306 20:58422230-58422252 CATGGTAGATAGGGGGTGCAGGG + Intronic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1176229262 20:64023451-64023473 GAGGACGGACAGAGGGTGCGTGG - Intronic
1176412639 21:6457376-6457398 GAGGGCACACAGAGGGTGAGAGG + Intergenic
1176513671 21:7767388-7767410 CAGGGGAGAGGGAGGGGGCGGGG - Intronic
1177567523 21:22844045-22844067 CAGGGGAGACAGGGTGTACGTGG - Intergenic
1178405862 21:32322827-32322849 CTGGGGAGGCGGAGGGTGCGAGG - Intronic
1178647784 21:34397912-34397934 CAGGGGAGAGGGAGGGGGCGGGG - Intronic
1179108463 21:38424599-38424621 CAGAGTAGACAGATGCTGTGGGG + Intronic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179688133 21:43065698-43065720 GAGGGCACACAGAGGGTGAGAGG + Intronic
1181084848 22:20435137-20435159 CAGGGAAGACTCAGGGTGCAAGG - Intronic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181982533 22:26775604-26775626 CAGGAGAGCCAGAGGGTGCCAGG + Intergenic
1182419223 22:30240811-30240833 CAGAGTAGACATAGTGTGTGGGG - Exonic
1183064269 22:35352779-35352801 CACGGTGCACAGAGGGTGCAGGG - Intergenic
1183069106 22:35383962-35383984 CAGGTTGAACAGAGGGTGTGGGG + Intronic
1184488183 22:44793972-44793994 CTGGGGAGACCGAGGGAGCGAGG + Intronic
1184744483 22:46448264-46448286 CAGGGAAGACAGAGGGCATGGGG + Intronic
1184920340 22:47601108-47601130 CGGGGTACACAGAGGCTGGGAGG - Intergenic
1185044344 22:48521652-48521674 CACGGGAGACGGAGGATGCGTGG + Intronic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
1185206204 22:49540638-49540660 CAGGGTAGAAACAGGGTCTGAGG + Intronic
1185329947 22:50247990-50248012 CGGTGCGGACAGAGGGTGCGGGG + Exonic
949509655 3:4757148-4757170 CTGGGTAGGCAGAGAGTGCCTGG - Intronic
949812073 3:8016637-8016659 CAGGGTAGACAGGGTGTATGTGG - Intergenic
952084787 3:29805908-29805930 CAGGTTAGTCAGTGAGTGCGTGG - Intronic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
953851911 3:46471089-46471111 CAGTGTTGACAGAGGCTGCGGGG + Intronic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955513966 3:59708438-59708460 CAGGTAAGACAGCGTGTGCGAGG + Intergenic
960205575 3:114893354-114893376 CAGGCTAGACAGACAGTGGGTGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961993896 3:131220688-131220710 TGGGGCAGACAGAGGGTGGGTGG - Intronic
963226827 3:142871057-142871079 CAGGGAAGACAGAGGTGGAGCGG - Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965532882 3:169792477-169792499 CAGGGTAGACAGAGTCTTTGTGG + Intergenic
967604756 3:191432325-191432347 CATGGCAGAAAGAGGGTGAGAGG + Intergenic
968610362 4:1554226-1554248 CAGGTCAGACAGAGGGTGAGGGG - Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
969396682 4:6926156-6926178 CAGCGGAGACAGAACGTGCGAGG - Intronic
969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG + Intronic
969518718 4:7663534-7663556 CAGTGTACACAGAGGGTACGTGG - Intronic
970093646 4:12437480-12437502 AAAGGTGGACAGAGGGAGCGGGG + Intergenic
970212474 4:13724460-13724482 AAGGGTAGTGGGAGGGTGCGGGG - Intergenic
970229391 4:13893160-13893182 CATGGCAGAAAGAGGGTGAGAGG + Intergenic
970985692 4:22154454-22154476 AAGGGTAGCTAGAGGGTGCAAGG + Intergenic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
972345871 4:38191873-38191895 CAGGGCAGACTCAGGGTGTGAGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975809611 4:78153207-78153229 CAAAGTAGGCAGAGGGTGAGGGG - Intronic
978620711 4:110632645-110632667 CCGGGTTGCCAGAGGGTCCGGGG - Intronic
980896993 4:138869147-138869169 AAGGGGAGAGAGAGGGTGAGGGG + Intergenic
981944801 4:150328733-150328755 GAGGGCAGTCAGAGGGTGGGTGG + Intronic
982257510 4:153465664-153465686 CAGTGTCCACAGAGGGTGCCGGG + Intergenic
984534775 4:180960664-180960686 CAGGGGAGACGGGGGGTGGGGGG - Intergenic
985877811 5:2613431-2613453 GAGGGAAGGCAGAGGGTGAGGGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986023883 5:3831580-3831602 CAGGACAGACAGAGAGTGAGGGG - Intergenic
986065370 5:4229574-4229596 CAGGGTTGGCGGGGGGTGCGAGG - Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
988918433 5:35919487-35919509 CAGGGTGGAAAGATGGTGCCGGG + Intronic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
994109191 5:95981156-95981178 CAGAGTATACACAGGGTGCTTGG - Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
998265246 5:140663191-140663213 CAGGGTAGACAGTGGCAGCGTGG - Intergenic
998295547 5:140966446-140966468 AAGGGAAGACAGAGGGGGAGGGG - Exonic
998955732 5:147436181-147436203 CAGGGTAGACAAAGGTGGAGAGG + Intronic
1002279769 5:178123476-178123498 CAGGGTAGCCAAAGGGAGTGAGG - Exonic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1002933970 6:1656022-1656044 CAGGTCACACAGAGAGTGCGTGG + Intronic
1004726803 6:18318926-18318948 CCGGGGAGGCAGAGGTTGCGGGG - Intergenic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1007404597 6:41627236-41627258 GAGGGTAGAGAGAGGGAGCTAGG - Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1010277068 6:73981107-73981129 CAGGGTAGGGAGAGGGAGCTGGG - Intergenic
1017972305 6:159323444-159323466 CATGGTAGACAGTTGGTGAGGGG + Intergenic
1018941135 6:168309417-168309439 GCGTGTAGACACAGGGTGCGGGG + Intronic
1018941141 6:168309446-168309468 GCGTGTAGACACAGGGTGCGGGG + Intronic
1019096388 6:169584062-169584084 CAGGGTAGACATAGGCGGGGAGG - Intronic
1019414956 7:922862-922884 CAGGATAGACAATGGGGGCGGGG - Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019621646 7:1995417-1995439 CAGGGTGGAGAGAGGAAGCGGGG - Intronic
1019740718 7:2671569-2671591 CGGGGGAGGCAGAGGGTGCGTGG + Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020014038 7:4820751-4820773 CAGGCTGGACTGAGGGCGCGTGG - Intronic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1020861775 7:13502528-13502550 CATGGAAGAAAGAGGGTGAGAGG - Intergenic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1022960707 7:35423749-35423771 AAGGGTAGATAGAGGGTGTGGGG - Intergenic
1027218919 7:76201928-76201950 GCGGGGAGGCAGAGGGTGCGGGG + Exonic
1029665423 7:101992143-101992165 CAGGGTAGAAAGAGGCTTGGAGG + Intronic
1030060504 7:105617540-105617562 CAGGGGAGAAATAGGGTGAGGGG + Intronic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1034243655 7:149627953-149627975 CAGGGAAGACACAGGATCCGGGG + Intergenic
1035109242 7:156466712-156466734 CAGTGAAGTGAGAGGGTGCGGGG + Intergenic
1035336703 7:158133928-158133950 CAGGGAAGACTCAGGGTGCTCGG + Exonic
1037905643 8:22714574-22714596 CAGGGTGGAGAGAGAGTGCCTGG + Intronic
1038451343 8:27641227-27641249 CAGTATTGACAGAGGGTGCCAGG + Intronic
1039194066 8:35010560-35010582 CATGGTAGGCAGAGGTTGCAGGG + Intergenic
1041765139 8:61411407-61411429 CAGTGGAGACAGAGGCTGGGTGG + Intronic
1041945836 8:63441787-63441809 CATGGTAGACAGAGGGTAAGTGG + Intergenic
1042054883 8:64754132-64754154 CAGAGGGGACAGAGGGTGTGAGG + Intronic
1042413340 8:68490488-68490510 CCGGGAAGAGAGAGGGTGTGAGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1048163590 8:132042264-132042286 CAAGATAGACAGAGGCTGCTGGG + Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049726190 8:144147590-144147612 CGGGGCAGACAGAGGGCGGGCGG + Intergenic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1050537891 9:6645823-6645845 GAGGGTAGGAAGAGGGGGCGGGG - Intergenic
1050566536 9:6889888-6889910 CAGCCTAGAAAGAGGGTGCCAGG - Intronic
1050798912 9:9584221-9584243 AAGGGGAGACAGAGGTTGCAGGG - Intronic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1055155826 9:73061742-73061764 CAGGGTAGGGAGTGGGTGGGGGG - Intronic
1057719479 9:97520437-97520459 TAGGGAAGACACAGGGTGGGAGG - Intronic
1059541165 9:115131967-115131989 CAGCCTAGACAGAAGGTGGGTGG - Intergenic
1059653295 9:116334834-116334856 CAGGGGAGACAGAGGGGCCGAGG - Intronic
1061415633 9:130445495-130445517 CAGGGTAAACTGAGGCTGCGGGG - Intronic
1061547862 9:131315175-131315197 CAGGGTAGGCTGAGGGGGCCAGG + Intergenic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1062554921 9:137109630-137109652 CAGGGGAGAGCGAGGGGGCGTGG - Intergenic
1186862001 X:13681832-13681854 CAGGCAAGAGAGAGTGTGCGGGG - Intronic
1187718472 X:22127872-22127894 CAGGGAAGACAGAGGTGGTGGGG + Intronic
1193199258 X:78668390-78668412 CAGAATAGATAGAGGGTGAGTGG - Intergenic
1194940721 X:100006733-100006755 CAGGGTAGACATAAGTTGTGAGG + Intergenic
1196712279 X:118775287-118775309 CAGGGTAGAGAGTGGCAGCGAGG + Intronic
1197608130 X:128608097-128608119 CAGTGTGGACAGAGGCTGCTAGG + Intergenic
1198940901 X:141953932-141953954 TAGGGAAGACAGAGAGTGAGGGG + Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic