ID: 991589909

View in Genome Browser
Species Human (GRCh38)
Location 5:68239772-68239794
Sequence CTTGCCAGTGACGTGTGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991589904_991589909 5 Left 991589904 5:68239744-68239766 CCGGAGCCAAAGGCAGATGACTC 0: 1
1: 0
2: 3
3: 10
4: 196
Right 991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG 0: 1
1: 0
2: 1
3: 5
4: 129
991589903_991589909 6 Left 991589903 5:68239743-68239765 CCCGGAGCCAAAGGCAGATGACT 0: 1
1: 0
2: 0
3: 34
4: 224
Right 991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG 0: 1
1: 0
2: 1
3: 5
4: 129
991589897_991589909 25 Left 991589897 5:68239724-68239746 CCGACCAGCCACAAGGCACCCCG 0: 1
1: 0
2: 0
3: 18
4: 146
Right 991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG 0: 1
1: 0
2: 1
3: 5
4: 129
991589899_991589909 21 Left 991589899 5:68239728-68239750 CCAGCCACAAGGCACCCCGGAGC 0: 1
1: 0
2: 1
3: 5
4: 156
Right 991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG 0: 1
1: 0
2: 1
3: 5
4: 129
991589906_991589909 -1 Left 991589906 5:68239750-68239772 CCAAAGGCAGATGACTCCCTGGC 0: 1
1: 0
2: 0
3: 20
4: 169
Right 991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG 0: 1
1: 0
2: 1
3: 5
4: 129
991589900_991589909 17 Left 991589900 5:68239732-68239754 CCACAAGGCACCCCGGAGCCAAA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG 0: 1
1: 0
2: 1
3: 5
4: 129
991589902_991589909 7 Left 991589902 5:68239742-68239764 CCCCGGAGCCAAAGGCAGATGAC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG 0: 1
1: 0
2: 1
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991589909 Original CRISPR CTTGCCAGTGACGTGTGATG CGG Intronic
901236670 1:7670925-7670947 CTTGCCACGGGCCTGTGATGAGG - Exonic
902858531 1:19227334-19227356 ATTCCCAGGGCCGTGTGATGGGG - Exonic
904953447 1:34263045-34263067 CTTGCCAGTGGCCTCTGACGTGG - Intergenic
905562753 1:38940514-38940536 CTGGCCAGTGACGGGTGGAGTGG - Intronic
906125517 1:43424875-43424897 CTTGGCAGGGAGGTGTCATGGGG - Intronic
906724528 1:48034449-48034471 CTTACCAGGAACATGTGATGTGG + Intergenic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
912951054 1:114120863-114120885 CTTTCCAGTGACGTAGGAGGGGG - Intronic
917653100 1:177098159-177098181 CTTGCCATTGGCGTCTGAAGGGG + Intronic
918246988 1:182669360-182669382 CTTGGCAGTGACTTGTGGGGTGG - Intronic
920913924 1:210242956-210242978 CTTGCCTGTGATGGGTGATGAGG + Exonic
920966214 1:210703413-210703435 CTTGCCAGTGATGTATGAGAAGG - Intronic
921987382 1:221327001-221327023 ATTCCCAGTGAGATGTGATGGGG - Intergenic
922881100 1:228981520-228981542 CTTCCCAGTGGCATGAGATGTGG + Intergenic
923337590 1:232984025-232984047 CTGGCCAGGGAGGTGTGGTGTGG + Exonic
1062760391 10:12729-12751 GTCACCAGTCACGTGTGATGAGG - Intergenic
1064423250 10:15208357-15208379 GGTGCCAGTGAGGTGAGATGGGG + Intergenic
1065614975 10:27511822-27511844 CTTGCCTGTGACAAGTGATAAGG + Intronic
1065916413 10:30357785-30357807 CTGGCCTGTGAGGTGTGTTGTGG - Intronic
1066340039 10:34522933-34522955 CCTGCCAGTGCCCTGTGCTGTGG - Intronic
1067668721 10:48300741-48300763 CTTGCCAGCGACCTCTGCTGGGG - Intergenic
1073368629 10:102966855-102966877 CTTGGGAGTGAGGTGGGATGAGG + Intronic
1075369522 10:121923599-121923621 CTTGCCAAAGACGTGGGATTGGG - Intronic
1078011234 11:7574665-7574687 CTTGCCAGGCCAGTGTGATGAGG + Intronic
1078334877 11:10455552-10455574 CTTCGCAGTCACCTGTGATGTGG + Intronic
1081912900 11:46711546-46711568 CTGGCAAGTGACTTGTGTTGTGG - Intergenic
1083843365 11:65316910-65316932 CTTGGCGCTGCCGTGTGATGGGG + Intronic
1085097133 11:73770412-73770434 CTGGCCAGTGAGATGTAATGGGG - Intergenic
1091793030 12:3282299-3282321 CTTTCCAGTGATGTGTGCTCAGG - Intronic
1094452767 12:30600162-30600184 CTGGCCCCTGACATGTGATGAGG + Intergenic
1100028631 12:90159948-90159970 CTTGCCAGGGACAAGTGCTGTGG - Intergenic
1103797384 12:123513682-123513704 CTTAGCAGTGACCTGTGAAGCGG - Intronic
1106114874 13:26808798-26808820 CTTGCAAGTGACATCTGAAGTGG - Intergenic
1106375267 13:29180656-29180678 CTAGCCAGTGACCTGTGACCTGG - Intronic
1110689259 13:78412807-78412829 CTTGCCACTGGCATCTGATGTGG - Intergenic
1112252995 13:97801113-97801135 CTTGCCAGTTAGCTGTGGTGAGG - Intergenic
1118506376 14:66417124-66417146 TTTGCCTGTGAGGTGAGATGGGG - Intergenic
1119167165 14:72503979-72504001 CTGCCCAGTGACTTGGGATGGGG - Intronic
1119318243 14:73713543-73713565 CATCCCAGTGAACTGTGATGAGG - Exonic
1122309672 14:100786431-100786453 CATGCCAGGGATGTGGGATGGGG + Intergenic
1122722650 14:103730788-103730810 TTTGCCAGCCACGTGTGCTGTGG + Intronic
1124484068 15:30100507-30100529 CTGGCCTGTGAGGTGTGTTGTGG + Intergenic
1124519512 15:30396717-30396739 CTGGCCTGTGAGGTGTGTTGTGG - Intergenic
1124539141 15:30569504-30569526 CTGGCCTGTGAGGTGTGTTGTGG + Intergenic
1124759509 15:32438068-32438090 CTGGCCTGTGAGGTGTGTTGTGG - Intergenic
1126859558 15:52870814-52870836 TTTGTCAGTGACATCTGATGGGG - Intergenic
1127311974 15:57760410-57760432 CTTGCCAGGGACTGGTGATTAGG + Intronic
1127515531 15:59689449-59689471 CTAGCCCGTGACGTCTGAGGGGG - Exonic
1129210259 15:74064278-74064300 CTGGCCTGTGAGGTGTGTTGTGG - Intergenic
1129403765 15:75301124-75301146 CTGGCCTGTGAGGTGTGTTGTGG + Intergenic
1129476774 15:75791082-75791104 CTGGCCTGTGAGGTGTGTTGTGG + Intergenic
1129727452 15:77908875-77908897 CTGGCCTGTGAGGTGTGTTGTGG - Intergenic
1129840427 15:78740098-78740120 CTGGCCTGTGAAGTGTGTTGTGG + Intergenic
1130282831 15:82532611-82532633 CTGGCCTGTGAAGTGTGTTGTGG + Intergenic
1132185532 15:99799177-99799199 CTGGCCTGTGAGGTGTGTTGTGG + Intergenic
1132431464 15:101765364-101765386 CTGGCCTGTGAGGTGTGTTGTGG - Intergenic
1134062002 16:11204951-11204973 CTGGCCAGTGACATCTGAGGAGG - Intergenic
1134410984 16:14003132-14003154 CTGGCCAGCCACGTGTGATGTGG - Intergenic
1138245956 16:55467388-55467410 CTTCCCTGTGAGGTGGGATGAGG - Intronic
1147176542 17:38659372-38659394 CTTGCCAGGGATGTGGGAAGGGG - Intergenic
1151433985 17:74082863-74082885 CTTGCCGGGGACTTGTGAAGAGG + Intergenic
1152953299 18:13083-13105 GTCACCAGTCACGTGTGATGAGG - Intergenic
1158489021 18:57893530-57893552 CTTGCCATTGGCGTCTGAAGAGG + Intergenic
1159382301 18:67676038-67676060 TTTGCCAGTAATGTGGGATGTGG + Intergenic
1160102292 18:75934348-75934370 CTTGGCAGTGACATGTAACGTGG - Intergenic
1162940203 19:14004975-14004997 CTTGTCAGTGACATGTGACTCGG + Intronic
1167374839 19:49105076-49105098 CTTGGCAGTGACGCATGCTGGGG + Intronic
1168499873 19:56884727-56884749 CCTGCCACTGCCCTGTGATGGGG + Intergenic
1202639545 1_KI270706v1_random:69702-69724 GTTCCCAGTGATGAGTGATGAGG + Intergenic
927960558 2:27238463-27238485 CTTGCCAGTGACCTGCGAGGTGG + Exonic
928089836 2:28367254-28367276 CTTTCCAGTCACCTGTGATATGG - Intergenic
928620504 2:33083466-33083488 CTGGGGAGTGACATGTGATGAGG + Intronic
928746291 2:34419384-34419406 CTTGCAATTGACATCTGATGGGG + Intergenic
930580118 2:53201093-53201115 CTAGCCAGTGAAGAGTGAGGAGG - Intergenic
942459274 2:176158396-176158418 CTTGCCAGGGTCGTGGGCTGGGG + Intronic
944114175 2:196170315-196170337 CTTGCCAGGGACGTTTGACGTGG - Intronic
946132047 2:217614024-217614046 CTTGACAGTGATGTGGTATGGGG + Intronic
947310901 2:228800577-228800599 CTTGCCAGTGTGGTCTGATATGG - Intergenic
948315270 2:237023826-237023848 CTTGACAGAGACCTGTGGTGGGG - Intergenic
1168786792 20:546230-546252 CTAGCCTGAGAGGTGTGATGTGG - Intergenic
1176522319 21:7833733-7833755 CCCGCCAGTGACAGGTGATGGGG + Intergenic
1178656339 21:34463745-34463767 CCCGCCAGTGACAGGTGATGGGG + Intergenic
1179303077 21:40129817-40129839 TGTGCCTGTGACGTGTGCTGGGG - Intronic
1180362396 22:11912168-11912190 GTTCCCAGTGATGAGTGATGAGG - Intergenic
1183319945 22:37158988-37159010 CAGGCCAGTGTCCTGTGATGGGG + Intronic
1184476561 22:44725190-44725212 CATGCCAGTGCCGTGTGGTCTGG + Intronic
1185223424 22:49640281-49640303 TTTGCCAGTGTCGTGTAATAAGG + Intronic
949975404 3:9453300-9453322 CGTGCTAGAGACGTGTGAAGAGG - Intronic
953193968 3:40714714-40714736 TTTGCCAGTGACCTGTCAGGTGG + Intergenic
953410337 3:42687304-42687326 CTTGCCAGTGGGGTGGGATTTGG + Intronic
963083929 3:141419556-141419578 CTTTCCAGTGACATGTGATGTGG + Intronic
963229181 3:142892466-142892488 CTTGGCAGAGAGGTGTGTTGAGG - Intergenic
969150907 4:5167674-5167696 CTTGCCCGTCACCTGGGATGAGG - Intronic
973369794 4:49236055-49236077 GTTCCCAGTGATGAGTGATGAGG + Intergenic
973391238 4:49559357-49559379 GTTCCCAGTGATGAGTGATGAGG - Intergenic
974494608 4:62610078-62610100 CATGTCAGTGACATGGGATGGGG + Intergenic
978411765 4:108433835-108433857 CTTGCCAGTGCCCTCTGATGTGG - Intergenic
982508265 4:156248016-156248038 CTTGTAAGTGAAGTCTGATGAGG - Intergenic
985183331 4:187289304-187289326 CATGCCAGGGAGCTGTGATGTGG - Intergenic
985983357 5:3490052-3490074 ACTGCCAGATACGTGTGATGTGG - Intergenic
987060381 5:14237419-14237441 GTTGTGAGTGTCGTGTGATGGGG + Intronic
987299152 5:16581287-16581309 TTTGTAAGTGAAGTGTGATGGGG - Intronic
989585782 5:43073057-43073079 CTTGCCACTGAAGACTGATGGGG - Intronic
991085573 5:62645652-62645674 TAGGCCTGTGACGTGTGATGCGG + Intergenic
991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG + Intronic
993872829 5:93272107-93272129 CTCACCAGTCACGTGTCATGAGG + Intergenic
1001224342 5:169930928-169930950 CTGGCCCATGACATGTGATGAGG - Intronic
1010465455 6:76162898-76162920 CTTGCAAGTGGCCTGTCATGGGG - Intergenic
1014239833 6:119004344-119004366 CTTGCTAATGACATGTGGTGTGG + Intronic
1014298545 6:119651342-119651364 CTTTCCACTGATGTGTGATTGGG + Intergenic
1019436362 7:1024294-1024316 CTTGCCAGAGACGTGGGACCAGG + Intronic
1022359168 7:29642604-29642626 CTGGCCAGTGTTTTGTGATGGGG + Intergenic
1024773201 7:52749998-52750020 CCCTCCAGTGGCGTGTGATGTGG - Intergenic
1026778634 7:73248338-73248360 CATGAGTGTGACGTGTGATGTGG - Intergenic
1027019494 7:74801746-74801768 CATGAGTGTGACGTGTGATGTGG - Intronic
1027068532 7:75144195-75144217 CATGAGTGTGACGTGTGATGTGG + Intronic
1032008513 7:128324631-128324653 CTTGGCGGTGACCCGTGATGAGG - Exonic
1032299757 7:130675872-130675894 CTGGGTAGTGACCTGTGATGTGG - Intronic
1034133110 7:148739187-148739209 CATACCAGTGAGGTGTGAGGAGG + Intronic
1037892174 8:22629206-22629228 CTTGCCAGGGCCGGGTAATGAGG - Intronic
1041442478 8:57912048-57912070 ACTGCCAGTGACCAGTGATGGGG - Intergenic
1041956065 8:63559065-63559087 CTTGGCAGAGATGTGTGATCTGG - Intergenic
1045678629 8:104634886-104634908 CTGGCCAGTGACCTGTGAAATGG - Intronic
1052605421 9:30692088-30692110 CTTGTCAATGACTTGTGCTGTGG - Intergenic
1054475549 9:65570210-65570232 ATCACCAGTGACCTGTGATGTGG - Intergenic
1058646582 9:107136489-107136511 CTTGCCCATGAAGTGGGATGGGG + Intergenic
1059228619 9:112696619-112696641 CTTGCCATTGGCGTCTGAAGTGG - Intronic
1060381608 9:123179820-123179842 CTTGCAGATGATGTGTGATGTGG - Intronic
1060538742 9:124414975-124414997 CATGCCAGTGCTGTGCGATGTGG - Intronic
1060696081 9:125710266-125710288 TTTGCCAGACAGGTGTGATGGGG + Intergenic
1203547654 Un_KI270743v1:140434-140456 GTTCCCAGTGATGAGTGATGAGG + Intergenic
1186411885 X:9351249-9351271 CTTGCCAGTGACTTTGAATGTGG + Intergenic
1188646190 X:32570089-32570111 CTTGCCATTGAGGTGGGAGGTGG - Intronic
1198197297 X:134376377-134376399 CTTGATTGTGACGTGTGTTGTGG + Intronic
1198573381 X:137983119-137983141 CTTGACAGTGACTTGGGTTGGGG - Intergenic
1199137044 X:144265917-144265939 CATGCCAGTGATGTGATATGGGG - Intergenic