ID: 991590947

View in Genome Browser
Species Human (GRCh38)
Location 5:68250817-68250839
Sequence CCTCAAGTAGTGCTGGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991590947_991590951 -2 Left 991590947 5:68250817-68250839 CCTAAAACCAGCACTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 991590951 5:68250838-68250860 GGAGCTTGAATTGGTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991590947 Original CRISPR CCTCAAGTAGTGCTGGTTTT AGG (reversed) Intronic
905194065 1:36260472-36260494 CCTTAAATAGTGGTCGTTTTTGG + Intronic
906618117 1:47249300-47249322 CCTCCCGAAGTGCTGGTTATAGG - Intergenic
907084840 1:51661974-51661996 TCTCAAGCAGTTCTGGTTTAAGG - Intronic
909121194 1:71606286-71606308 CAACAAGTAGTGCTAGTTATTGG - Intronic
909711688 1:78657975-78657997 CTTCAAGTAGTCCTGGTGTGGGG + Intronic
920571618 1:207022235-207022257 CCCAGAGAAGTGCTGGTTTTGGG + Exonic
924301800 1:242646973-242646995 CCTAAATTACTGCTGTTTTTAGG - Intergenic
1069117471 10:64525874-64525896 TGTCAAGTAGTAATGGTTTTAGG - Intergenic
1072253237 10:93598401-93598423 CCACAAGTAGTGGTGGAGTTGGG + Intronic
1075187161 10:120273448-120273470 CCTGAAGCAGTGCTGGTCTCTGG + Intergenic
1076258529 10:129047542-129047564 CGTGATGTAGTGCTGATTTTTGG + Intergenic
1077175054 11:1185463-1185485 CCAGAAGTTGTGCTGGTTGTAGG - Intronic
1077175230 11:1186615-1186637 CCAGAAGTTGTGCTGGTTGTAGG - Intronic
1078095716 11:8295458-8295480 GTACAATTAGTGCTGGTTTTGGG - Intergenic
1081297925 11:41414587-41414609 GCTCCAGGAGTCCTGGTTTTTGG + Intronic
1086902562 11:92384158-92384180 CCTCAAGCAGTGATTTTTTTTGG + Intronic
1093849942 12:24023314-24023336 GATCAAGTAATACTGGTTTTGGG - Intergenic
1095482415 12:42650072-42650094 CCTCAAGTTGTCCTCTTTTTTGG + Intergenic
1096824609 12:54265310-54265332 CTTGAAGTACTGATGGTTTTAGG + Intronic
1097141766 12:56908402-56908424 CCTGAAGCAGAGCTGGGTTTGGG + Intergenic
1097695285 12:62769248-62769270 CCCCAAGTGGTGCAGGTTTGTGG - Intronic
1099220243 12:79905235-79905257 GCTCTAGTAGTGCTGTTTTTAGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1103700776 12:122847739-122847761 AGTCAAGTCGTGCAGGTTTTGGG + Intronic
1104479691 12:129096617-129096639 CCTCAAGGAGTGCTGGTAGCAGG - Intronic
1105242686 13:18621758-18621780 TCTCGAGTAGAGCTGGTCTTTGG + Intergenic
1107951504 13:45465830-45465852 TATTAAGCAGTGCTGGTTTTCGG + Intronic
1110539771 13:76695079-76695101 CCTCAAGTTGTGTTAGCTTTAGG - Intergenic
1111882102 13:93970268-93970290 CCTCTAGTAGAGCTGATTTATGG - Intronic
1112881460 13:104110704-104110726 TTTCAAGTTGTGCTGGCTTTGGG - Intergenic
1117962210 14:61174580-61174602 CCTCATGCAGGGCTGGTCTTAGG + Intergenic
1120291183 14:82572832-82572854 TTTCAAGTAGAGCTGGTTTTAGG - Intergenic
1123488616 15:20762846-20762868 TCTCGAGTAGAGCTGGTCTTTGG - Intergenic
1123545112 15:21331919-21331941 TCTCGAGTAGAGCTGGTCTTCGG - Intergenic
1125056414 15:35362734-35362756 CACCAAGTTGTGCTGTTTTTGGG + Intronic
1129399716 15:75274941-75274963 CCTCAAGTAGGGATGGTGGTAGG - Intronic
1129473188 15:75766370-75766392 CCTCAAGTAGGGATGGTGGTAGG + Intergenic
1129731433 15:77934776-77934798 CCTCAAGTAGGGATGGTGGTAGG + Intergenic
1129937617 15:79463825-79463847 CCACAAGCAGGGCTGGGTTTTGG + Intronic
1130131748 15:81149389-81149411 CATCAAGTACTGCAGGATTTAGG + Intergenic
1202953458 15_KI270727v1_random:59190-59212 TCTCGAGTAGAGCTGGTCTTTGG - Intergenic
1138966162 16:62086472-62086494 GCACAAGTAATGCTGGTTTTTGG + Intergenic
1140310774 16:73846416-73846438 ACTCAACTAGTTCTGGTTTGGGG + Intergenic
1140964420 16:79951066-79951088 CATGAAGTAGTGTTGGTTGTGGG + Intergenic
1146525567 17:33564380-33564402 CCTCCAGGAGTGCTGATTTAAGG + Intronic
1146674558 17:34764395-34764417 CCTCCAGCCCTGCTGGTTTTGGG + Intergenic
1149641868 17:58208045-58208067 CCTCAAGCAGTGCTGTCTCTTGG - Intronic
1154446256 18:14438119-14438141 TCTCGAGTAGAGCTGGTCTTTGG - Intergenic
1162315471 19:9936081-9936103 CCTCAAGCTGGGCTGGTTTGGGG - Intronic
1162378010 19:10316418-10316440 CTTCATGGAGTGCTGGTTTCTGG + Exonic
1163737747 19:18991807-18991829 CCTGGAGTGGAGCTGGTTTTGGG - Intronic
1168033617 19:53701471-53701493 GCTCAAGTGGTCCTGTTTTTTGG + Intergenic
925150751 2:1613039-1613061 CCTCAAGGAATTCTGGTTTAGGG + Intergenic
926000294 2:9325796-9325818 CCTCAGGTAGTGCTGGGTCCTGG + Intronic
929370019 2:41211794-41211816 CCTCAGTTAGTGCTGGTTCACGG - Intergenic
930610793 2:53540750-53540772 CCTCAAGTAGTTCTGGAGCTGGG + Intronic
931226262 2:60334543-60334565 GCTCAAGTAGTGATGGGTGTAGG - Intergenic
935182012 2:100700022-100700044 ACTCCAGTATTGCTGGTTTAGGG - Intergenic
938005224 2:127784322-127784344 CATAAATTAGTGCTTGTTTTTGG - Intronic
939203932 2:139075368-139075390 CTTGAAGTAGTGCTCGTTTCAGG - Intergenic
940895836 2:159081266-159081288 CCTCATGTAATGGTGGTTTCTGG + Intronic
943326450 2:186504064-186504086 CAACAAGTATGGCTGGTTTTGGG + Exonic
943466086 2:188230857-188230879 CCTCTAGTACTGCTGGGTTAGGG - Intergenic
946745636 2:222842895-222842917 CCTCAAGAAGTACTAGATTTGGG + Intergenic
946956326 2:224933895-224933917 CCTTAAATAATGCTGGATTTGGG - Intronic
1175002642 20:55645784-55645806 CCTTAAGTAGAGAGGGTTTTAGG + Intergenic
1175175439 20:57109063-57109085 CCTTTTGTAGTGCTGGTTTCTGG + Intergenic
1175544402 20:59768953-59768975 CCCCAAGTAGTATTGGTTTGTGG + Intronic
1180879294 22:19192573-19192595 CCTCCAGCACTGCTGGGTTTGGG + Intronic
1181937190 22:26447354-26447376 CCAGAGGTAGAGCTGGTTTTCGG - Intronic
949285923 3:2404384-2404406 CCTCATATTTTGCTGGTTTTTGG + Intronic
951699157 3:25477438-25477460 CCCCAAGTTGAACTGGTTTTGGG + Intronic
962033056 3:131621598-131621620 CCTCAGATACTGCAGGTTTTAGG + Intronic
963820589 3:149888492-149888514 TCTGAAGTAGTCCTGCTTTTGGG + Intronic
970675500 4:18444368-18444390 TTTCAAGTAGTTCTAGTTTTGGG - Intergenic
976123081 4:81804279-81804301 GCACAAGCAGTGCTGGTTTGAGG + Intronic
978339706 4:107709370-107709392 CCTTAGGTATTGCTGGGTTTGGG + Intronic
979532828 4:121787289-121787311 CCTCATCTAGTTCTGGTTGTTGG + Intergenic
979774346 4:124569649-124569671 CCAGAAGTAGGCCTGGTTTTAGG - Intergenic
983239645 4:165217651-165217673 CTTCAACTAGTGCTGATTCTGGG + Intronic
983541154 4:168912011-168912033 CCTAAAGAAGTCCAGGTTTTAGG + Intronic
984955843 4:185044816-185044838 CCTCTAGTGCTGCTGGTTTATGG - Intergenic
991590947 5:68250817-68250839 CCTCAAGTAGTGCTGGTTTTAGG - Intronic
993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG + Intergenic
993692414 5:91018488-91018510 CCTCAAGTAGTGTTTGCTTTGGG + Intronic
994113121 5:96030810-96030832 CCTCAAGTAATCCTCCTTTTGGG - Intergenic
994287489 5:97987307-97987329 CCTAAAATAATGCTGTTTTTAGG + Intergenic
1000818284 5:165951488-165951510 CCTAAAGCAGTGCTGTTTTCAGG + Intergenic
1001103431 5:168833072-168833094 CCCCAAGTAATGATGGTTGTGGG - Intronic
1002561391 5:180084519-180084541 CCTGAAGTAGGGCAGGTTGTGGG + Intergenic
1002598381 5:180339078-180339100 GCTCAAGTAGTGCTTATTTAAGG - Intronic
1006093346 6:31641146-31641168 CCCCAAGCAGTGCAGGTTTAGGG + Exonic
1007814788 6:44513990-44514012 GCTCAAGCAGTGCTGGCTTTGGG - Intergenic
1013756781 6:113471354-113471376 CCTCCAGTTGTGCTGGTGGTAGG - Intergenic
1017385954 6:153883835-153883857 CCTCCAAAAGTGCTGGTTTTAGG - Intergenic
1021640148 7:22728632-22728654 CCTCTAGTGGTGTTTGTTTTAGG + Intronic
1022041513 7:26586291-26586313 CCTCAAGAACTGCGGGTGTTAGG + Intergenic
1022656273 7:32322343-32322365 CCTCCCAAAGTGCTGGTTTTGGG - Intergenic
1023297663 7:38732708-38732730 CCTCACGTAATGCTGGTATTAGG + Intronic
1025961561 7:66226919-66226941 CATCAATTAGTGCTACTTTTTGG + Intronic
1028393455 7:90340884-90340906 CTTCAGCTAGTGCTGATTTTAGG - Intronic
1031865506 7:127034838-127034860 CCTACAGTAGTGCTATTTTTAGG - Intronic
1034942938 7:155243701-155243723 CCTCTAGTACTGCTGGGTTAGGG - Intergenic
1036066810 8:5389976-5389998 CCTGCATTACTGCTGGTTTTTGG + Intergenic
1038262907 8:26013088-26013110 GGTTAAGAAGTGCTGGTTTTGGG + Intronic
1038697800 8:29821449-29821471 CCTCAAGATGTGCTTGGTTTTGG - Intergenic
1041570031 8:59327494-59327516 ATTCAAGTTCTGCTGGTTTTAGG - Intergenic
1044853003 8:96447311-96447333 ACTCAAGTAGAGCTACTTTTTGG - Intergenic
1047619950 8:126596218-126596240 ACTCACATGGTGCTGGTTTTTGG + Intergenic
1047741911 8:127813468-127813490 CCTAAAGTAGAGCTGGGTCTAGG - Intergenic
1049156265 8:141068577-141068599 CTTCTGGCAGTGCTGGTTTTGGG + Intergenic
1049452188 8:142668100-142668122 CCTCAAGTACTGCTGGCCTGCGG - Intronic
1051068942 9:13138828-13138850 TGTCAAGTAGTGCTGGCTGTTGG - Intronic
1051707923 9:19900014-19900036 CCTCAAGTAGTGAAGGTTCAGGG - Intergenic
1057857139 9:98610336-98610358 CCTCACGTAGTGCAGGCTGTGGG - Intronic
1058100441 9:100913587-100913609 CCTCAAGGAGCTCTTGTTTTGGG - Intergenic
1059392518 9:114008164-114008186 CCTCGTGTTGTCCTGGTTTTGGG + Intronic
1193005510 X:76614460-76614482 CCTTGCGTTGTGCTGGTTTTCGG - Intergenic
1193185099 X:78502294-78502316 CCTGAAGTAGTGGTGGCTATGGG + Intergenic
1196557601 X:117107799-117107821 ACTCAAGTATAGCTGGTTTTGGG - Intergenic
1199617724 X:149671253-149671275 CCTCAAGCAGTGGTCATTTTGGG + Intergenic
1199624919 X:149731996-149732018 CCTCAAGCAGTGGTCATTTTGGG - Intergenic
1199983353 X:152933240-152933262 CCTCACATGGTGCTGGTCTTGGG + Intronic