ID: 991592350

View in Genome Browser
Species Human (GRCh38)
Location 5:68266157-68266179
Sequence TAGTATTAGGAGAGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991592350 Original CRISPR TAGTATTAGGAGAGGGCAGG GGG (reversed) Intronic
900887304 1:5423982-5424004 TGGAATTAGGAGAGGGCCGTAGG - Intergenic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
903162590 1:21499927-21499949 TAGTGTAAGGGGAGGCCAGGAGG + Intergenic
903164357 1:21510012-21510034 TGGGAGGAGGAGAGGGCAGGAGG + Intronic
903169216 1:21541710-21541732 TAGGGTAGGGAGAGGGCAGGGGG + Intronic
903255055 1:22091684-22091706 TAGTACTGGGAGGGGGAAGGGGG - Exonic
904297370 1:29528818-29528840 AGGGATTGGGAGAGGGCAGGGGG + Intergenic
904530774 1:31167572-31167594 TATTATTAGGAGATGCCATGGGG + Intergenic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
906191734 1:43903454-43903476 TGGTTTTAGGAGTGGGGAGGAGG - Intronic
906252696 1:44323134-44323156 TATTATTAGGATAGGGAAAGAGG - Intronic
906518423 1:46453061-46453083 TGGGAGGAGGAGAGGGCAGGAGG - Intergenic
906681769 1:47731664-47731686 TAGCATTAAAAGAGGGGAGGGGG - Intergenic
907289896 1:53407059-53407081 GAGAATTAGGAGAGGGCCGAGGG + Intergenic
907335968 1:53699860-53699882 TAGGATTAGGTGAGGCCATGAGG - Intronic
908052851 1:60251349-60251371 TCGGAGTAGGAGAGGGCAGGGGG + Intergenic
909279744 1:73734443-73734465 TAATAATAGGAGAAAGCAGGTGG + Intergenic
910049960 1:82961730-82961752 TATTACTAGCTGAGGGCAGGAGG + Intergenic
910681621 1:89871446-89871468 TATTTTTAGGAGAGGGAAGGGGG - Intronic
911149257 1:94581322-94581344 TAGTGTTTGGTCAGGGCAGGGGG + Intergenic
912816082 1:112829751-112829773 TAGTTTTGGGAGAGGGAAGCTGG - Intergenic
913302590 1:117387992-117388014 TAGTATTTGGAGATGATAGGGGG - Intronic
914720160 1:150282764-150282786 AAAGATTGGGAGAGGGCAGGAGG + Intronic
915053513 1:153103142-153103164 CAGTGTTAGGAGTGAGCAGGTGG - Intronic
919582395 1:199392550-199392572 TAGTATCAGTAGAGGTCATGTGG + Intergenic
924632993 1:245760011-245760033 TAGTGACAGGAGAGGGCAGGAGG + Intronic
1062917970 10:1256383-1256405 TGGGATGAGGAGAGGTCAGGGGG + Intronic
1063704486 10:8417694-8417716 GAGTTTGAGGAGTGGGCAGGAGG + Intergenic
1064271458 10:13870018-13870040 TATTATTAGGAGAGGGGCTGGGG + Intronic
1064326508 10:14356180-14356202 TAGCATCAGGAGAGAGAAGGTGG + Intronic
1065452184 10:25870493-25870515 TAGGGTCAGGAGAGGGAAGGAGG + Intergenic
1067162970 10:43842706-43842728 AAGGATCAGGACAGGGCAGGTGG + Intergenic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1071012665 10:80955977-80955999 AAGTATTAAGCAAGGGCAGGTGG - Intergenic
1072882413 10:99240787-99240809 TAGTAGAAGGAAAGGGCAGGCGG - Intergenic
1074090499 10:110248948-110248970 TAGACTTAGGATAGGGGAGGTGG + Intronic
1074296584 10:112194978-112195000 TTGGATTAGGATAGTGCAGGTGG - Intronic
1076473908 10:130739229-130739251 TAGGAGAAGAAGAGGGCAGGGGG + Intergenic
1078655470 11:13234884-13234906 GTGTATTAGGTGGGGGCAGGAGG - Intergenic
1079567152 11:21897135-21897157 TAGTATTAGTACAGGCCAGTAGG - Intergenic
1081867490 11:46367563-46367585 TTGTCTTGGGAGAGGGCGGGTGG + Intronic
1083089949 11:60189525-60189547 TAGTGTTGGGAGATGGCAGCTGG - Intergenic
1084376023 11:68778226-68778248 TAGTCTTGGGAGAGGGTAGCAGG + Intronic
1084675471 11:70631426-70631448 TTTTATTTGGAGAAGGCAGGTGG - Intronic
1087071420 11:94085059-94085081 TAGGCTTAGTAGAGAGCAGGAGG + Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1088036235 11:105319355-105319377 TGTTATTAGGAGACTGCAGGAGG + Intergenic
1089550562 11:119273203-119273225 TAGTACTTTGAGAGGCCAGGGGG - Intronic
1090668726 11:128931272-128931294 TAGTCTTAGATGAGGTCAGGAGG + Intergenic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091929829 12:4386692-4386714 TACTAGTAGGGGAGGGTAGGAGG + Intergenic
1092492244 12:8956200-8956222 TGGTGCCAGGAGAGGGCAGGAGG - Intronic
1097192549 12:57226357-57226379 AAGCAGCAGGAGAGGGCAGGTGG - Exonic
1099416944 12:82400774-82400796 AAGTATTGCGAGAGGGTAGGGGG - Intronic
1102538570 12:113601085-113601107 GAGTATAAGGAGAGAGGAGGGGG + Intergenic
1103471009 12:121181071-121181093 TACTTTTAAGAGAGGGCAGTTGG - Intronic
1104479920 12:129098884-129098906 GAGGATTAAGAGAGGGTAGGAGG - Intronic
1105446575 13:20462196-20462218 TAGTGGGAGGAGGGGGCAGGAGG + Intronic
1106077156 13:26470503-26470525 TACTTTTAGGGGAGGGAAGGAGG - Intergenic
1107659118 13:42621059-42621081 TAGAATTAGGTGAGTGGAGGGGG + Intergenic
1111352356 13:87047613-87047635 TAGAAATAGAGGAGGGCAGGAGG - Intergenic
1113149902 13:107252038-107252060 TGGCAGTGGGAGAGGGCAGGAGG + Intronic
1118941811 14:70346031-70346053 AAGCTTTAGGAGAGGGCAGTGGG - Intronic
1119590577 14:75883822-75883844 GAGTAGTAGGAAAGGGCAGTAGG + Intronic
1121501757 14:94443660-94443682 TTGTATTAGGGGATGCCAGGAGG - Intronic
1122123610 14:99567522-99567544 TAATCTTAAGATAGGGCAGGAGG + Intronic
1123931144 15:25172239-25172261 TAGGACTAGGACAGGGCAGGTGG - Intergenic
1127697962 15:61470409-61470431 GGGGATTAGGAGAGGGCTGGAGG - Intergenic
1130323216 15:82857133-82857155 TAGGATTAGGTGAGGGCGTGAGG + Intronic
1130696360 15:86135652-86135674 TAGGATCAGGGGAGGGCAAGAGG + Intergenic
1131416660 15:92265862-92265884 TAGAATTAAGTGGGGGCAGGAGG - Intergenic
1132042254 15:98535305-98535327 TAGTTTTAGTAGAGGGGGGGAGG - Intergenic
1132222681 15:100116792-100116814 TATTCTTAGGGGAGGACAGGAGG + Intronic
1134071770 16:11264759-11264781 TTCTATTAGGAGAGGGTATGGGG - Intronic
1134642966 16:15843962-15843984 TAGATTTAGGTGATGGCAGGCGG - Intronic
1135290058 16:21228598-21228620 GAGTTTTAGGACAGTGCAGGAGG + Intergenic
1135669936 16:24366752-24366774 TAGGATTTGGAGAGGGCAAGCGG - Intergenic
1136004905 16:27322733-27322755 AAGTATTAGAAGAGAGAAGGTGG - Intronic
1138953764 16:61946089-61946111 GGATATTAGGAGTGGGCAGGAGG - Intronic
1139760754 16:69182963-69182985 TTGATTTAGGAGAGGGCTGGAGG + Intronic
1143627023 17:8116352-8116374 TAGTAGTAGGGGAGGGAATGGGG + Intronic
1143886758 17:10070759-10070781 TAGATTTAGAATAGGGCAGGAGG - Intronic
1155494465 18:26429092-26429114 TAGTCTTTGGAGAGGCAAGGAGG + Intergenic
1156349373 18:36290217-36290239 TGGTTTTAGGACTGGGCAGGGGG + Intergenic
1157438644 18:47692655-47692677 TGGTAGAAGGAGAGGGCAGTGGG - Intergenic
1157641944 18:49224548-49224570 TAGGATTAGGTGAGGTCATGAGG + Intronic
1159083786 18:63764218-63764240 TAGGATTATGTGAGGGCAGTGGG + Intronic
1162183942 19:8889868-8889890 TAGCACCAGGAGAGGGCTGGCGG + Exonic
1166395166 19:42434308-42434330 AGGTATGAGGAGAGGGCAGGAGG - Intronic
1166496198 19:43304972-43304994 TGGGAATGGGAGAGGGCAGGGGG - Intergenic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167935393 19:52902240-52902262 TAGTATTGGGAGACGGAAGCTGG + Intergenic
1168453366 19:56483926-56483948 CAGTAATGGGAGGGGGCAGGGGG - Intergenic
925437767 2:3855756-3855778 TAGAATGAGGAGAGCGCAAGTGG - Intergenic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
928566756 2:32560434-32560456 TAGCATTAGGAGAGGCCAACTGG - Intronic
932299943 2:70659596-70659618 TAGTTATAGGAGAGTGGAGGGGG + Exonic
934962318 2:98687543-98687565 GAATATTAGGAGGGGGAAGGTGG - Intronic
935113151 2:100110339-100110361 AAGTATTAGCAGACGGCAAGAGG + Intronic
936372772 2:111917046-111917068 TAGTGTTTGGGGAGGCCAGGTGG - Intronic
937615786 2:123920834-123920856 TAGTTTTAGGAGGTGGGAGGTGG - Intergenic
939523161 2:143258585-143258607 TGGTATTTGAAGAGGGGAGGAGG + Intronic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
942308247 2:174629594-174629616 AAGTTTTAGGAGAGGTCTGGTGG + Intronic
943339163 2:186656789-186656811 AAGCCTAAGGAGAGGGCAGGTGG + Intronic
944127053 2:196306033-196306055 TAGTATTAGGAGATGGGGGCAGG + Intronic
945065036 2:205941187-205941209 TAGGGTTAGAAGAGGTCAGGAGG - Intergenic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
947818099 2:233051520-233051542 AAGTAGGAGGAGGGGGCAGGAGG + Intergenic
1168831151 20:845908-845930 TTGTATTGGGGGAGGGGAGGAGG - Exonic
1173585080 20:44176223-44176245 AGGTATTAGGTGAGGGGAGGTGG - Intronic
1173826746 20:46052688-46052710 TAGTAATCAGAAAGGGCAGGTGG + Intronic
1177607277 21:23397095-23397117 TAGTGTTAGGAGAAAGGAGGGGG - Intergenic
1178689380 21:34738634-34738656 TTGAATCAGGAGAGGGCAAGAGG + Intergenic
1180704750 22:17802400-17802422 TGGTGTTAGGAGAAGGCAAGAGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1184294583 22:43515502-43515524 TAGAATTGGGAGTGGGCAAGAGG + Intergenic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
952073269 3:29665467-29665489 TAGTGTTTGGAAAGGGGAGGAGG - Intronic
953236850 3:41114401-41114423 TAATAATTAGAGAGGGCAGGAGG + Intergenic
953867824 3:46599526-46599548 TGGTAGTGGGAGCGGGCAGGGGG - Intronic
954447267 3:50553473-50553495 TTGATTTTGGAGAGGGCAGGGGG - Intergenic
954604853 3:51901343-51901365 TAGTATTGGGAGATGGAAGCTGG - Intronic
955775274 3:62426117-62426139 TAGTATTAGGAAAGGGTGTGGGG + Intronic
955963875 3:64368214-64368236 TAGAATTATGAGTGGGTAGGTGG + Intronic
961779185 3:129311625-129311647 AAATATTAGGAGGGGGCAGGTGG - Intergenic
964932962 3:162048171-162048193 TAGTGTTGGGAGAGGGAAGCTGG + Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
966320240 3:178694362-178694384 GAGAATTGGGAGAGGACAGGAGG - Intronic
967171037 3:186824003-186824025 TTGTGTTAGGAGAGGGCTGAAGG + Intergenic
967491037 3:190090974-190090996 TAGTTTTGAGAGATGGCAGGCGG - Intronic
970742170 4:19251316-19251338 TGATATTTGGAGAGGCCAGGAGG + Intergenic
971038817 4:22727187-22727209 TAGTACTGGGAGGGGGAAGGGGG + Intergenic
972196786 4:36662965-36662987 TTGTAGTAGGAGATGGCAGGTGG - Intergenic
973943482 4:55933598-55933620 TAGTTTTAGGGGAGTGAAGGAGG + Intergenic
975545881 4:75560105-75560127 TGGTTTTTGGAGAGGGAAGGAGG + Intronic
975693063 4:76984698-76984720 TAGGATAAAGACAGGGCAGGAGG + Intronic
978874231 4:113619496-113619518 GAGTAGTAGGAGAGGTTAGGGGG - Intronic
979120209 4:116889424-116889446 TAGTGTTAGGTGAGGTCATGAGG - Intergenic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
985099809 4:186447636-186447658 AAGTATTTTGAGAGAGCAGGAGG - Intronic
990586693 5:57218451-57218473 AGGTATTAGGTGAGGGGAGGTGG + Intronic
991592350 5:68266157-68266179 TAGTATTAGGAGAGGGCAGGGGG - Intronic
994100185 5:95883113-95883135 TAGTATGGGGTGGGGGCAGGGGG + Intergenic
994749309 5:103719209-103719231 TAGAAATAGGAGTGGGCGGGGGG - Intergenic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
996705536 5:126494227-126494249 TGGTAGTAGTAGATGGCAGGTGG - Intronic
998592869 5:143496559-143496581 AACTATTAGGAGAGAGCAAGAGG + Intergenic
998898044 5:146821249-146821271 TGGTATTAAGGGATGGCAGGTGG - Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999495692 5:152094603-152094625 TGCTATTAGGTGAGGGAAGGAGG - Intergenic
1001620919 5:173084526-173084548 TAGTACTGGGAGGGGGAAGGGGG + Intronic
1001641578 5:173247517-173247539 TAGAAGTGGGAGAGGGGAGGTGG + Intergenic
1001718862 5:173840180-173840202 GAGGAGAAGGAGAGGGCAGGAGG + Intergenic
1001882567 5:175257455-175257477 TGGTCCTAGGAGAGGGTAGGAGG + Intergenic
1002922736 6:1584604-1584626 TAGTTTTGTGGGAGGGCAGGTGG - Intergenic
1003025425 6:2550916-2550938 AAGAATTAGGAGGGGGCAGGTGG + Intergenic
1003903179 6:10674210-10674232 TAGGATTAGGTGAGGTCATGAGG - Intronic
1004022530 6:11788251-11788273 AAGGATGAGGAGAGGGCAGAGGG - Intronic
1004182864 6:13395939-13395961 TGGGATGAGCAGAGGGCAGGCGG + Intronic
1006250226 6:32777342-32777364 TAGTATTAGATGAGGTCATGAGG - Intergenic
1007622335 6:43222732-43222754 GGGAATGAGGAGAGGGCAGGCGG + Intronic
1009788533 6:68369486-68369508 TAGGATTAGGAGTGGGAAGGTGG + Intergenic
1010021397 6:71163874-71163896 TAGGATCAGGACAGGGCTGGAGG - Intergenic
1010189929 6:73184877-73184899 GAGTATTTGGAGAGAGAAGGGGG + Intronic
1014848176 6:126306119-126306141 TAGTATGAGGAGGGGGCATGTGG + Intergenic
1014867713 6:126552287-126552309 TTGTTTTGGGAGAGGGGAGGGGG + Intergenic
1016878758 6:148889543-148889565 TAATATCATGACAGGGCAGGGGG - Intronic
1017452200 6:154564697-154564719 TAGGGTTAGGAGAGGTCATGAGG - Intergenic
1018276096 6:162133183-162133205 TAGGAATAGGACTGGGCAGGAGG + Intronic
1019223704 6:170494223-170494245 GAGAATGAGGAGAGGGCAGATGG - Intergenic
1020795370 7:12672326-12672348 TAGCATTTTGAGAGGCCAGGTGG - Intergenic
1021406536 7:20274272-20274294 TATTTTTTGGAGGGGGCAGGTGG - Intergenic
1022497320 7:30861238-30861260 TCGTCTTAGGAGAGGGGAAGGGG - Intronic
1023069060 7:36410246-36410268 TAGAATGAGGAGAGGGCAGTAGG - Intronic
1023192360 7:37596398-37596420 TAGGTTTAGGTGAGGTCAGGAGG - Intergenic
1024465573 7:49708899-49708921 TAGAGTTAGGAGAAAGCAGGAGG + Intergenic
1024652411 7:51416350-51416372 TACTAAGAGGAGAGGGCAGAGGG + Intergenic
1025037589 7:55606999-55607021 TACTAAAAGGAGAGGGCAGAGGG + Intergenic
1025040364 7:55638071-55638093 TAGTACTCGGAGGGGGAAGGGGG + Intergenic
1027954204 7:84858931-84858953 TAATGTTTGGAGAGGGAAGGGGG - Intergenic
1028398306 7:90396757-90396779 TAGTACTGGGAGAGGGAAGGTGG - Intronic
1028885355 7:95926821-95926843 GAGTCTCAGGAGAGGGCAGGTGG - Intronic
1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG + Intergenic
1032913316 7:136458982-136459004 TAGTTTTAGTTGAGGCCAGGAGG + Intergenic
1033487106 7:141801724-141801746 TAGGAGTAGGAAAGGGGAGGAGG + Intergenic
1034859230 7:154581877-154581899 TAGCAGCAGGAGAAGGCAGGTGG - Intronic
1034969823 7:155412031-155412053 TATTATTATGAGAATGCAGGTGG + Intergenic
1035079374 7:156203438-156203460 TAGTCTTAGGAGAGGGGAGTTGG + Intergenic
1035395432 7:158531774-158531796 TTCTATGAGCAGAGGGCAGGTGG - Intronic
1038971126 8:32636701-32636723 TGGTATTGGGTGAGGGGAGGGGG + Intronic
1039476817 8:37843123-37843145 GAGTAGAGGGAGAGGGCAGGTGG + Exonic
1041041146 8:53847168-53847190 TAGTATTTGCCTAGGGCAGGGGG - Intergenic
1041128987 8:54676328-54676350 CAGTAATAGGAGAGGGTAGTAGG + Intergenic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1044793521 8:95872499-95872521 CAGTATTGGCACAGGGCAGGGGG - Intergenic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1048907983 8:139106648-139106670 TAGAAACAGGAGAGGGCAGATGG - Intergenic
1050808965 9:9719497-9719519 TGGTACCAGCAGAGGGCAGGAGG - Intronic
1052508146 9:29381241-29381263 TAGTATTGGGAGATGGAAGCTGG - Intergenic
1056198471 9:84251514-84251536 TTGCTTTAGGAGAGGACAGGAGG - Intergenic
1058902219 9:109451848-109451870 TAGTGTTATGGGAAGGCAGGAGG + Intronic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1059808617 9:117831400-117831422 TAATATTAGCAAAGGGTAGGGGG - Intergenic
1060820346 9:126658198-126658220 TAGGAGTGGGACAGGGCAGGAGG + Intronic
1061375082 9:130219498-130219520 TAGAAGTGGGAGAGGCCAGGAGG - Intronic
1061480561 9:130895953-130895975 TAGTCTGATGAGAGGGCAGGCGG + Intergenic
1186033377 X:5393701-5393723 TAGAATTAGGTGAGGTCACGAGG + Intergenic
1186525296 X:10242694-10242716 TACAATTAGGGGAGGGGAGGGGG - Intergenic
1189532758 X:41903267-41903289 TAGTGTTGGGAGACGGCAGAAGG + Intronic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192594718 X:72394473-72394495 AAGTACTAGGAGACGTCAGGTGG - Intronic
1193992355 X:88323609-88323631 TAGTATCAGAAGAGGGAAGGTGG - Intergenic
1195399603 X:104447443-104447465 TAGGAATATGAGAGGGCAGTGGG - Intergenic
1197354690 X:125423515-125423537 TAGTGTTTGCAGAGGGCTGGGGG + Intergenic
1197594906 X:128453000-128453022 TAGGATTAGGGGAGGTCATGGGG - Intergenic
1197886508 X:131223649-131223671 TTGCATTAGGAGAGAGCATGAGG + Intergenic
1199873075 X:151914550-151914572 TAGTAATGGGAAAGGGGAGGCGG - Intronic
1199873602 X:151916594-151916616 TAGTAATGGGAAAGGGGAGGCGG - Intronic
1199874308 X:151919311-151919333 TAGTAATGGGAAAGGGGAGGGGG - Intronic
1200937518 Y:8751283-8751305 TAATCCTAGGAGAGGGCAGATGG - Intergenic
1200937685 Y:8752528-8752550 TAATCCTAGGAGAGGGCAGATGG + Intergenic
1202626649 Y:56866616-56866638 CAGTATTTTGAGAGGGCAAGGGG + Intergenic