ID: 991593398

View in Genome Browser
Species Human (GRCh38)
Location 5:68277934-68277956
Sequence TGTACTCAGTGGAGCAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991593398 Original CRISPR TGTACTCAGTGGAGCAAAGG TGG (reversed) Intronic
900639375 1:3681456-3681478 GGTTCTCAGGGGAGCAATGGTGG + Intronic
902176951 1:14657559-14657581 GGTCCTCAGTGCGGCAAAGGCGG - Intronic
904233498 1:29097404-29097426 CGTACTTAGTGGAGGAAATGTGG + Intronic
905039800 1:34946569-34946591 AGTACTCAGTGGAAGAGAGGAGG + Intergenic
905890788 1:41517116-41517138 TTTTCCCAGTGGAGCAAACGAGG - Intronic
906023186 1:42649493-42649515 TATACTCAATGGAGAAAAGTTGG + Intronic
906285371 1:44584215-44584237 TGAATTGAGTGGACCAAAGGAGG - Intronic
907935013 1:59034107-59034129 TGTCCTCATTGGAGCAAAGAAGG - Intergenic
908673860 1:66578916-66578938 TGTACTTTGGGGAGCAGAGGAGG - Intronic
910094072 1:83499858-83499880 AGTAATAAGGGGAGCAAAGGAGG + Intergenic
914912207 1:151796619-151796641 TGGACCCTGGGGAGCAAAGGTGG + Intergenic
920766679 1:208840236-208840258 TGAAGTGAGTGGGGCAAAGGAGG + Intergenic
920952390 1:210584715-210584737 TGAAGACAGTGGGGCAAAGGAGG - Intronic
1063459815 10:6207989-6208011 CATGATCAGTGGAGCAAAGGAGG + Intronic
1063699608 10:8371699-8371721 TGTACAGAGTGGAGGAAAGAGGG + Intergenic
1066188771 10:33036778-33036800 TGTGCTCAGTGGAGCCAGTGGGG + Intergenic
1068768642 10:60795580-60795602 TGGACTCCGTGGAGCAAGAGCGG - Intergenic
1070379306 10:75866252-75866274 TGTGCTGTGTGGAGCAGAGGTGG - Intronic
1073699693 10:105912391-105912413 TATACTCAGTGGTGAAAAGTTGG + Intergenic
1073839551 10:107482626-107482648 TGTGTTCAGTGGAGGAGAGGTGG + Intergenic
1074581181 10:114721086-114721108 TGTGCTCAGTTGAGATAAGGAGG + Intergenic
1080756244 11:35202250-35202272 TGTACTCTTTAGAGCAAAGTTGG + Intronic
1080788761 11:35500299-35500321 TGTGCTCAGTGGAGAAAATGAGG - Intronic
1082765458 11:57164034-57164056 AGTCCTCAGTGGAGCACATGAGG - Intergenic
1084298526 11:68229115-68229137 AGTACTCAGGGGTGCAGAGGTGG - Intergenic
1085408059 11:76275841-76275863 TGTACTAAATGGAGAAAATGTGG + Intergenic
1086561019 11:88169368-88169390 TGTGCTCAGTGTAGCAAAGCTGG - Intronic
1087169217 11:95033370-95033392 TGTGCTAAGTTGAGCAAAGATGG - Intergenic
1087226231 11:95602565-95602587 AATATTGAGTGGAGCAAAGGAGG + Intergenic
1087584668 11:100103660-100103682 TGTACTGACTGGAGCAAAGTAGG - Intronic
1087849447 11:103011300-103011322 TTTCATCAGTGGAACAAAGGAGG - Intergenic
1090138418 11:124225409-124225431 TGCCCTCAGTGGAGCGAATGCGG - Intergenic
1090140233 11:124250353-124250375 TGCCCTCAGTGGAGCGAATGTGG - Exonic
1090621551 11:128565248-128565270 TGTCCTCAGTGGCGGAAGGGAGG - Intronic
1090643330 11:128747479-128747501 AGGCCTCACTGGAGCAAAGGTGG - Intronic
1096095098 12:48929477-48929499 TGTACACAGTGGTCCAAAGTAGG - Intronic
1098985811 12:77010713-77010735 TGTTCTCATTGGAGAAAATGAGG + Intergenic
1099812433 12:87601064-87601086 TTTACTCAGTAGAGCAAAACTGG - Intergenic
1100004668 12:89880641-89880663 TGTACTCAGAAGAGCCATGGGGG + Intergenic
1103202154 12:119096656-119096678 TGTACAGAGTGGAGAAAGGGAGG - Intronic
1104105728 12:125657204-125657226 TTAACACAGAGGAGCAAAGGCGG - Exonic
1105887078 13:24651295-24651317 TGTTCTTAGCGGAGGAAAGGAGG - Intergenic
1109616262 13:64837478-64837500 TGTACCCAGTAGAGCAACAGGGG + Intergenic
1109780607 13:67106618-67106640 TGCACTCCGTGGAGCTAATGGGG + Intronic
1109806106 13:67445410-67445432 TGTACTCAGTGTCTCAAAAGGGG + Intergenic
1109921482 13:69067598-69067620 TATATTGAGTAGAGCAAAGGAGG - Intergenic
1111814249 13:93130782-93130804 TGTACTGAATGGAGAAAAGCTGG - Intergenic
1114762408 14:25330540-25330562 TGGAGGCAGTGGAGCAAAGCTGG - Intergenic
1119365176 14:74085029-74085051 TGTTCCCAGTAGAGCAAAGAAGG - Intronic
1121932763 14:97988050-97988072 TTTACTCAGAGGAGCAAATTGGG - Intergenic
1124699059 15:31895232-31895254 TGTACTCAGTGGAACTGAGCTGG + Intergenic
1125043620 15:35221369-35221391 AGTACTTAGTGGAGCCATGGGGG - Intronic
1127699222 15:61480969-61480991 TGTACTCTCTCAAGCAAAGGAGG - Intergenic
1129389292 15:75212611-75212633 TGTTCTCAGGGCAGCTAAGGTGG + Intergenic
1130208209 15:81898194-81898216 TGTAATAAATGGAGCCAAGGTGG - Intergenic
1131314846 15:91326266-91326288 TATACTCAGTGGGGAAAAGCTGG - Intergenic
1136516670 16:30772693-30772715 TGTAATCAGAGGAGCCAATGTGG + Intronic
1137861463 16:51850852-51850874 TGTACTGAGTGGTCCAGAGGAGG - Intergenic
1138203453 16:55107020-55107042 TGTACTCAGGTGTGCAAACGGGG + Intergenic
1141045857 16:80715675-80715697 TGTTCTCATTTGAGCAATGGAGG - Intronic
1144484396 17:15652852-15652874 GGTACTCAGTGGAGATCAGGAGG + Intronic
1146442476 17:32909217-32909239 TCAACTCAGTGGAGCACAGTGGG + Intergenic
1148152046 17:45402768-45402790 AGTACACAGTGGAGCTGAGGGGG - Exonic
1151683289 17:75633110-75633132 TTTACTCATTGGAGCAGAGTGGG - Intronic
1152571462 17:81123032-81123054 TGTACACAGGGGTGCAGAGGTGG + Intronic
1152693218 17:81730970-81730992 TGTGCCCAGTGAAGCAGAGGTGG + Intergenic
1155741469 18:29294061-29294083 GCTATTCAGTGGAGAAAAGGTGG + Intergenic
1157388441 18:47280352-47280374 TGTTCTCAGTGACACAAAGGAGG - Intergenic
1157797774 18:50591102-50591124 TGGATTCAGTTGAGCAAATGAGG + Intronic
1158453616 18:57587730-57587752 TATACACATTTGAGCAAAGGGGG + Intergenic
1159123962 18:64201542-64201564 TGTCCTCAGTGGCTCAGAGGAGG + Intergenic
1160370638 18:78369694-78369716 TGTACTAAATTCAGCAAAGGTGG - Intergenic
1164590305 19:29503195-29503217 TGACCTCAGTGGAGCATTGGGGG + Intergenic
1166052714 19:40269969-40269991 TGCCCTCAGAGAAGCAAAGGGGG - Intronic
1166181609 19:41112974-41112996 TGTTCTCAGAGGGGCAGAGGAGG - Intergenic
1167049837 19:47071715-47071737 TTTACCCAGTGGAGCAGAGTTGG - Intronic
925185768 2:1845376-1845398 TATATTCAGGTGAGCAAAGGAGG - Intronic
927317290 2:21698948-21698970 TGTACTCAATGGAGGCAAGGGGG - Intergenic
928613447 2:33013218-33013240 AGTACTAAGTGCTGCAAAGGAGG - Intronic
929646164 2:43630694-43630716 GCTACTCAGTGGACCAAAGAGGG - Intergenic
929717873 2:44331708-44331730 TGTACTGACTGCTGCAAAGGAGG - Intronic
929910314 2:46084126-46084148 TGTACTCTGGGGAGAAAACGAGG + Intronic
933356485 2:81216426-81216448 AGTACTCAGTGGACAAAGGGAGG + Intergenic
934520183 2:95015222-95015244 TGTACAGCGTGGAGCCAAGGAGG - Intergenic
935429366 2:102958016-102958038 TGCACTAAGTGGAAGAAAGGTGG - Intergenic
937244588 2:120484454-120484476 CCTACCCAGTGGAGCACAGGGGG - Intergenic
939741007 2:145906353-145906375 TGTACTTAGTGGAGAGGAGGAGG - Intergenic
939813682 2:146867803-146867825 TGCACTCAGTGGTGCAGAGGAGG + Intergenic
940053334 2:149487621-149487643 TTAACTCAGTGGAGAAAAGTCGG + Intergenic
940091630 2:149926113-149926135 TGTCCTCAGTGGAAAACAGGTGG + Intergenic
940345704 2:152625593-152625615 TGCACTCTGTGCAGCAAAGCCGG + Intronic
940629421 2:156219115-156219137 TGTACTCAGTGGATCACTGTTGG - Intergenic
946166103 2:217864892-217864914 TGTACGCAGTGGGGCAGAGTTGG + Intronic
948216910 2:236239002-236239024 TGCACTCAGTGGGGGAAGGGGGG + Intronic
1168822698 20:786342-786364 GGTACTCTGGGGAGCAGAGGTGG + Intergenic
1169025068 20:2363644-2363666 TGTACTCAGTGGGGACAAGTGGG - Intergenic
1174284221 20:49460928-49460950 AGTGCTCAGTGGAACAAGGGCGG - Intronic
1174420733 20:50397441-50397463 TGGATTGAGTGGAGCAAAGCTGG - Intergenic
1174588117 20:51624385-51624407 GGTCCTCAGTGGACCAAGGGAGG - Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178297499 21:31422697-31422719 GGTGCTCATTGGTGCAAAGGTGG - Intronic
1178671876 21:34598020-34598042 TGTACTGAGTAGAGAAAAGATGG + Intronic
1182005393 22:26955428-26955450 GGTGCTCCGTGGAGCAAAAGAGG - Intergenic
1184105118 22:42362956-42362978 TGTACCAAGTCGAGCACAGGCGG - Intergenic
1184342882 22:43895746-43895768 TCTACTGAGTGGAGTAACGGGGG - Intergenic
949930837 3:9077238-9077260 GGTGCTCACTGAAGCAAAGGAGG - Intronic
951037248 3:17947286-17947308 TGTACTCCGAGATGCAAAGGGGG + Intronic
951615297 3:24536122-24536144 TTTAGCCAATGGAGCAAAGGTGG - Intergenic
951840824 3:27032215-27032237 TCTCCTGAGTGGAGAAAAGGTGG - Intergenic
952504114 3:33992118-33992140 TGTTTTCAGTGGAGCAGTGGTGG + Intergenic
955105697 3:55895751-55895773 TGCACTAAGTGGGTCAAAGGAGG - Intronic
956518947 3:70082615-70082637 TGTAGTCAGTGGAAAAAATGTGG + Intergenic
958177274 3:90012422-90012444 TTTACTCTGTGGAACAAAAGAGG - Intergenic
963204214 3:142615816-142615838 TATACTCAATGGAGCTAAAGTGG - Intronic
963796055 3:149632020-149632042 GCTACTCAGGGGAGCTAAGGTGG - Intronic
964527133 3:157626920-157626942 TATACGCTGTGGAGCAAAGGTGG + Intronic
966757077 3:183381304-183381326 AGGACTCAGAGGAGCAAAGGCGG + Intronic
967031219 3:185609066-185609088 TGGATTCAGTTGATCAAAGGAGG + Intronic
973023293 4:45232391-45232413 TGTACTCAGTGGAAGGATGGAGG - Intergenic
978944016 4:114472545-114472567 TGTCCTCAGTGTGGCAAATGGGG - Intergenic
984019965 4:174473742-174473764 TGGACCCGGAGGAGCAAAGGGGG + Intergenic
988483097 5:31645933-31645955 TGTACTCAGTAGGGGGAAGGGGG + Intronic
989234092 5:39124420-39124442 TGGACTTAGTGGAGAAATGGAGG - Intronic
991593398 5:68277934-68277956 TGTACTCAGTGGAGCAAAGGTGG - Intronic
993630890 5:90284756-90284778 TGTTCTCATTGGAGCAATGCTGG + Intergenic
995691498 5:114830664-114830686 TGTAGTCATTGGAGGAAAGAAGG - Intergenic
1000008601 5:157210814-157210836 TGTCATCAGTGGAGAAAAGTAGG + Intronic
1001031993 5:168269731-168269753 TGTACTCAGTGGGCAAATGGTGG - Intergenic
1002846286 6:948080-948102 TGGGCTAAGTGGAGCACAGGTGG + Intergenic
1002854554 6:1025804-1025826 TGTACTCAATGGAACCAAGGAGG - Intergenic
1004806667 6:19210676-19210698 TGCTGTCAGTGGAGCACAGGTGG + Intergenic
1006598773 6:35212367-35212389 TTCACTCAGTGGTGGAAAGGGGG - Intergenic
1006833491 6:36983185-36983207 TTGACCCAGTGGAGCAAAGGAGG + Intronic
1007461187 6:42020410-42020432 TCAACACAGTGGAGCAAGGGAGG - Intronic
1010578373 6:77562286-77562308 TTTACTCAGTAGAGAAAAGCAGG - Intergenic
1013710743 6:112894958-112894980 TGCACTCATTGCAGCAAAGCTGG - Intergenic
1013975372 6:116071703-116071725 TTGAATCAGTGAAGCAAAGGAGG - Intergenic
1013981892 6:116140335-116140357 TGTGCCCAGAAGAGCAAAGGTGG - Intronic
1028017713 7:85736226-85736248 TGTACGCAGTGGTGGTAAGGAGG - Intergenic
1028326627 7:89534846-89534868 TGTACTCTGTGGATCAAAGCTGG - Intergenic
1028419290 7:90613909-90613931 TGAAATCAGTGAAGCCAAGGTGG + Intronic
1032454982 7:132066404-132066426 TTTGCTCAGTGGGGCACAGGGGG - Intergenic
1033759683 7:144425120-144425142 TGTTCTCAGTGTATCAAAGAAGG - Intergenic
1034826221 7:154266177-154266199 TGTACACAGTGTAGCACTGGAGG - Intronic
1035383627 7:158456272-158456294 TCTTCTCTGTGGAGCAATGGGGG - Intronic
1035427489 7:158790111-158790133 TGTCATCAGTGGAATAAAGGAGG - Intronic
1035581827 8:744946-744968 TGTCCTCAGTGCAGCAGAGATGG + Intergenic
1036504824 8:9345754-9345776 TGTTCTCAGTGCAGAAAACGGGG - Intergenic
1036640575 8:10580997-10581019 TTCACTGAGTGGAGGAAAGGAGG - Intergenic
1041021501 8:53643061-53643083 GGGACTCAGTGGAGAAAAGGAGG - Intergenic
1042336506 8:67635218-67635240 TGTTCACAGTGGAGCAAACTTGG - Intronic
1042768763 8:72355904-72355926 TTTTGTCAGTGAAGCAAAGGGGG - Intergenic
1047132107 8:122033075-122033097 TGTCCTCAGTGGAGGGAAGCAGG - Intergenic
1050308356 9:4328457-4328479 TGTACACACTGGTGAAAAGGTGG - Intronic
1050987477 9:12101817-12101839 TGTACCCAGTGGAGCCACAGGGG - Intergenic
1051492051 9:17677199-17677221 TGTACCCATTGAAGCAAACGTGG + Intronic
1052004115 9:23325603-23325625 TATAAACAGTGGAGCAATGGTGG - Intergenic
1053194939 9:36110027-36110049 TGTGCTCACTGAGGCAAAGGCGG - Exonic
1053364425 9:37512490-37512512 GGTGCTCAGAGGAGCTAAGGTGG - Exonic
1053491138 9:38504075-38504097 AGAACTCAGTATAGCAAAGGAGG - Intergenic
1055901698 9:81246389-81246411 TGTAATCAGTGGCGAAGAGGAGG + Intergenic
1057454317 9:95193808-95193830 GGTGCTCACTGGAGCAAAAGAGG + Intronic
1058098219 9:100887744-100887766 TCTTCTCAGAGGAGCAAAGCAGG + Intergenic
1060065893 9:120500916-120500938 GGTACTGAGTGGAGTAAGGGGGG + Intronic
1061037135 9:128120182-128120204 GGTACTCTGTGCAGGAAAGGGGG + Intergenic
1062125561 9:134859346-134859368 TGTAATGAGTGGAGAAATGGAGG + Intergenic
1062270475 9:135705930-135705952 TGGCCTCACTGGAGCAGAGGTGG + Intronic
1188106354 X:26152128-26152150 AGTACTTAATGGAGCAAGGGAGG - Intergenic
1191682100 X:63851428-63851450 TGGACTTAGTGGAGGAAAGCGGG + Intergenic
1196896380 X:120340924-120340946 TGTACTCAGGGGGAAAAAGGTGG + Intergenic
1197268962 X:124405268-124405290 TGTAGACAGAAGAGCAAAGGAGG + Intronic
1199594776 X:149497953-149497975 TGTCCTCAGTGGAGTAAAGATGG - Intronic
1201752773 Y:17451462-17451484 TGGACTCAGGGGAGAAAGGGTGG + Intergenic