ID: 991595652

View in Genome Browser
Species Human (GRCh38)
Location 5:68302732-68302754
Sequence GTCTAGTAGTAGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991595647_991595652 -10 Left 991595647 5:68302719-68302741 CCTGAAAGACATAGTCTAGTAGT No data
Right 991595652 5:68302732-68302754 GTCTAGTAGTAGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991595652 Original CRISPR GTCTAGTAGTAGAGGGGAGA GGG Intergenic
No off target data available for this crispr