ID: 991596929

View in Genome Browser
Species Human (GRCh38)
Location 5:68315799-68315821
Sequence CTCCCTTCAAAGCAGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991596925_991596929 -10 Left 991596925 5:68315786-68315808 CCTATCACCAGCACTCCCTTCAA No data
Right 991596929 5:68315799-68315821 CTCCCTTCAAAGCAGGCACAGGG No data
991596924_991596929 -7 Left 991596924 5:68315783-68315805 CCACCTATCACCAGCACTCCCTT No data
Right 991596929 5:68315799-68315821 CTCCCTTCAAAGCAGGCACAGGG No data
991596920_991596929 22 Left 991596920 5:68315754-68315776 CCGCAGGGTCAGTGAGCTCTTCG No data
Right 991596929 5:68315799-68315821 CTCCCTTCAAAGCAGGCACAGGG No data
991596923_991596929 -6 Left 991596923 5:68315782-68315804 CCCACCTATCACCAGCACTCCCT No data
Right 991596929 5:68315799-68315821 CTCCCTTCAAAGCAGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991596929 Original CRISPR CTCCCTTCAAAGCAGGCACA GGG Intergenic
No off target data available for this crispr