ID: 991597156

View in Genome Browser
Species Human (GRCh38)
Location 5:68317309-68317331
Sequence AAAAATGTGCAGATGCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991597156_991597160 24 Left 991597156 5:68317309-68317331 CCAAGATGCATCTGCACATTTTT No data
Right 991597160 5:68317356-68317378 GGCTAAAAGCAACTATTTTTAGG No data
991597156_991597157 3 Left 991597156 5:68317309-68317331 CCAAGATGCATCTGCACATTTTT No data
Right 991597157 5:68317335-68317357 CTCAAGACAATCTCCCTGTCTGG No data
991597156_991597161 28 Left 991597156 5:68317309-68317331 CCAAGATGCATCTGCACATTTTT No data
Right 991597161 5:68317360-68317382 AAAAGCAACTATTTTTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991597156 Original CRISPR AAAAATGTGCAGATGCATCT TGG (reversed) Intergenic
No off target data available for this crispr