ID: 991603128

View in Genome Browser
Species Human (GRCh38)
Location 5:68373239-68373261
Sequence TGACGTCAGCCTGAGGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991603128_991603134 26 Left 991603128 5:68373239-68373261 CCTGAGACCTCAGGCTGACGTCA No data
Right 991603134 5:68373288-68373310 AGCCACCTGGAAGTAATCTCTGG No data
991603128_991603133 13 Left 991603128 5:68373239-68373261 CCTGAGACCTCAGGCTGACGTCA No data
Right 991603133 5:68373275-68373297 CAGGTTGTTAATGAGCCACCTGG No data
991603128_991603131 -6 Left 991603128 5:68373239-68373261 CCTGAGACCTCAGGCTGACGTCA No data
Right 991603131 5:68373256-68373278 ACGTCATCACAACAATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991603128 Original CRISPR TGACGTCAGCCTGAGGTCTC AGG (reversed) Intergenic
No off target data available for this crispr