ID: 991607674

View in Genome Browser
Species Human (GRCh38)
Location 5:68419925-68419947
Sequence CAGTAGTGCTAGAGGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991607665_991607674 8 Left 991607665 5:68419894-68419916 CCCCTACTGCAAAAATAACCTCC No data
Right 991607674 5:68419925-68419947 CAGTAGTGCTAGAGGCCGTGGGG No data
991607668_991607674 -10 Left 991607668 5:68419912-68419934 CCTCCAGCTGCTCCAGTAGTGCT No data
Right 991607674 5:68419925-68419947 CAGTAGTGCTAGAGGCCGTGGGG No data
991607667_991607674 6 Left 991607667 5:68419896-68419918 CCTACTGCAAAAATAACCTCCAG No data
Right 991607674 5:68419925-68419947 CAGTAGTGCTAGAGGCCGTGGGG No data
991607664_991607674 17 Left 991607664 5:68419885-68419907 CCTTTAATGCCCCTACTGCAAAA No data
Right 991607674 5:68419925-68419947 CAGTAGTGCTAGAGGCCGTGGGG No data
991607666_991607674 7 Left 991607666 5:68419895-68419917 CCCTACTGCAAAAATAACCTCCA No data
Right 991607674 5:68419925-68419947 CAGTAGTGCTAGAGGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991607674 Original CRISPR CAGTAGTGCTAGAGGCCGTG GGG Intergenic
No off target data available for this crispr