ID: 991610153

View in Genome Browser
Species Human (GRCh38)
Location 5:68441377-68441399
Sequence GAAGTGGCTGTTCCTCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991610144_991610153 24 Left 991610144 5:68441330-68441352 CCTTGGCTATCTTTGACACAGTG No data
Right 991610153 5:68441377-68441399 GAAGTGGCTGTTCCTCAGTGGGG No data
991610146_991610153 0 Left 991610146 5:68441354-68441376 CCCATTTTACCTCTTTCTGGCCA No data
Right 991610153 5:68441377-68441399 GAAGTGGCTGTTCCTCAGTGGGG No data
991610143_991610153 30 Left 991610143 5:68441324-68441346 CCTGTTCCTTGGCTATCTTTGAC No data
Right 991610153 5:68441377-68441399 GAAGTGGCTGTTCCTCAGTGGGG No data
991610149_991610153 -9 Left 991610149 5:68441363-68441385 CCTCTTTCTGGCCAGAAGTGGCT No data
Right 991610153 5:68441377-68441399 GAAGTGGCTGTTCCTCAGTGGGG No data
991610147_991610153 -1 Left 991610147 5:68441355-68441377 CCATTTTACCTCTTTCTGGCCAG No data
Right 991610153 5:68441377-68441399 GAAGTGGCTGTTCCTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991610153 Original CRISPR GAAGTGGCTGTTCCTCAGTG GGG Intergenic
No off target data available for this crispr