ID: 991611877

View in Genome Browser
Species Human (GRCh38)
Location 5:68457928-68457950
Sequence ACCAGAAATGTTGCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991611871_991611877 12 Left 991611871 5:68457893-68457915 CCCTCTAGATGCCAGGAGCAGCC No data
Right 991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG No data
991611875_991611877 -10 Left 991611875 5:68457915-68457937 CCCAGTCATGACAACCAGAAATG 0: 2
1: 13
2: 109
3: 420
4: 1053
Right 991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG No data
991611872_991611877 11 Left 991611872 5:68457894-68457916 CCTCTAGATGCCAGGAGCAGCCC No data
Right 991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG No data
991611869_991611877 23 Left 991611869 5:68457882-68457904 CCTGACTTCTACCCTCTAGATGC No data
Right 991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG No data
991611873_991611877 1 Left 991611873 5:68457904-68457926 CCAGGAGCAGCCCCAGTCATGAC No data
Right 991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG No data
991611874_991611877 -9 Left 991611874 5:68457914-68457936 CCCCAGTCATGACAACCAGAAAT No data
Right 991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991611877 Original CRISPR ACCAGAAATGTTGCCAGACA TGG Intergenic
No off target data available for this crispr