ID: 991614149

View in Genome Browser
Species Human (GRCh38)
Location 5:68478614-68478636
Sequence CCTGAAATGTTTCTATTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991614143_991614149 18 Left 991614143 5:68478573-68478595 CCCTTCTCATAGCATTAAGCTGT No data
Right 991614149 5:68478614-68478636 CCTGAAATGTTTCTATTTCAGGG No data
991614144_991614149 17 Left 991614144 5:68478574-68478596 CCTTCTCATAGCATTAAGCTGTC No data
Right 991614149 5:68478614-68478636 CCTGAAATGTTTCTATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991614149 Original CRISPR CCTGAAATGTTTCTATTTCA GGG Intergenic
No off target data available for this crispr