ID: 991614149 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:68478614-68478636 |
Sequence | CCTGAAATGTTTCTATTTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
991614143_991614149 | 18 | Left | 991614143 | 5:68478573-68478595 | CCCTTCTCATAGCATTAAGCTGT | No data | ||
Right | 991614149 | 5:68478614-68478636 | CCTGAAATGTTTCTATTTCAGGG | No data | ||||
991614144_991614149 | 17 | Left | 991614144 | 5:68478574-68478596 | CCTTCTCATAGCATTAAGCTGTC | No data | ||
Right | 991614149 | 5:68478614-68478636 | CCTGAAATGTTTCTATTTCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
991614149 | Original CRISPR | CCTGAAATGTTTCTATTTCA GGG | Intergenic | ||
No off target data available for this crispr |