ID: 991618153

View in Genome Browser
Species Human (GRCh38)
Location 5:68518063-68518085
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991618147_991618153 -2 Left 991618147 5:68518042-68518064 CCAAATTGTACCTAGGCCTTTGA No data
Right 991618153 5:68518063-68518085 GATTCTGCACAGAGGCCTAGGGG No data
991618146_991618153 4 Left 991618146 5:68518036-68518058 CCAAAGCCAAATTGTACCTAGGC No data
Right 991618153 5:68518063-68518085 GATTCTGCACAGAGGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr