ID: 991618153 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:68518063-68518085 |
| Sequence | GATTCTGCACAGAGGCCTAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 991618147_991618153 | -2 | Left | 991618147 | 5:68518042-68518064 | CCAAATTGTACCTAGGCCTTTGA | No data | ||
| Right | 991618153 | 5:68518063-68518085 | GATTCTGCACAGAGGCCTAGGGG | No data | ||||
| 991618146_991618153 | 4 | Left | 991618146 | 5:68518036-68518058 | CCAAAGCCAAATTGTACCTAGGC | No data | ||
| Right | 991618153 | 5:68518063-68518085 | GATTCTGCACAGAGGCCTAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 991618153 | Original CRISPR | GATTCTGCACAGAGGCCTAG GGG | Intergenic | ||
| No off target data available for this crispr | |||||