ID: 991620724

View in Genome Browser
Species Human (GRCh38)
Location 5:68542992-68543014
Sequence AGGTGGGTGTGGGGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991620715_991620724 18 Left 991620715 5:68542951-68542973 CCAAATGGAAGAAAAAGAAGAAA No data
Right 991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991620724 Original CRISPR AGGTGGGTGTGGGGGGAGAA AGG Intergenic
No off target data available for this crispr