ID: 991629325

View in Genome Browser
Species Human (GRCh38)
Location 5:68639060-68639082
Sequence AGTGACCTGCTTCTAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991629325_991629326 1 Left 991629325 5:68639060-68639082 CCATTCTTTAGAAGCAGGTCACT No data
Right 991629326 5:68639084-68639106 ACTCTAGCCCACACTCACGATGG No data
991629325_991629330 29 Left 991629325 5:68639060-68639082 CCATTCTTTAGAAGCAGGTCACT No data
Right 991629330 5:68639112-68639134 ATTAATTAAGTTCCATCTCCTGG No data
991629325_991629327 4 Left 991629325 5:68639060-68639082 CCATTCTTTAGAAGCAGGTCACT No data
Right 991629327 5:68639087-68639109 CTAGCCCACACTCACGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991629325 Original CRISPR AGTGACCTGCTTCTAAAGAA TGG (reversed) Intergenic
No off target data available for this crispr