ID: 991630022

View in Genome Browser
Species Human (GRCh38)
Location 5:68647301-68647323
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991630022_991630029 21 Left 991630022 5:68647301-68647323 CCATCCCCAGCCCACTTGGCCAG No data
Right 991630029 5:68647345-68647367 CTTGTGTCTCTACCTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991630022 Original CRISPR CTGGCCAAGTGGGCTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr