ID: 991632273

View in Genome Browser
Species Human (GRCh38)
Location 5:68668027-68668049
Sequence ATGGAACCACAGATGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632273_991632279 8 Left 991632273 5:68668027-68668049 CCTAACTCCATCTGTGGTTCCAT No data
Right 991632279 5:68668058-68668080 GCAGTTCCCGCCACCTCCAGGGG No data
991632273_991632277 6 Left 991632273 5:68668027-68668049 CCTAACTCCATCTGTGGTTCCAT No data
Right 991632277 5:68668056-68668078 CTGCAGTTCCCGCCACCTCCAGG No data
991632273_991632278 7 Left 991632273 5:68668027-68668049 CCTAACTCCATCTGTGGTTCCAT No data
Right 991632278 5:68668057-68668079 TGCAGTTCCCGCCACCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632273 Original CRISPR ATGGAACCACAGATGGAGTT AGG (reversed) Intergenic
No off target data available for this crispr