ID: 991632471

View in Genome Browser
Species Human (GRCh38)
Location 5:68670100-68670122
Sequence GCAGGTCTGGAGTGGGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632471_991632478 11 Left 991632471 5:68670100-68670122 CCCGGGCCCCACTCCAGACCTGC No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632471 Original CRISPR GCAGGTCTGGAGTGGGGCCC GGG (reversed) Intergenic