ID: 991632472

View in Genome Browser
Species Human (GRCh38)
Location 5:68670101-68670123
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632472_991632478 10 Left 991632472 5:68670101-68670123 CCGGGCCCCACTCCAGACCTGCT No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632472 Original CRISPR AGCAGGTCTGGAGTGGGGCC CGG (reversed) Intergenic