ID: 991632472 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:68670101-68670123 |
| Sequence | AGCAGGTCTGGAGTGGGGCC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 991632472_991632478 | 10 | Left | 991632472 | 5:68670101-68670123 | CCGGGCCCCACTCCAGACCTGCT | No data | ||
| Right | 991632478 | 5:68670134-68670156 | CTATTTTAACAGTATTCACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 991632472 | Original CRISPR | AGCAGGTCTGGAGTGGGGCC CGG (reversed) | Intergenic | ||