ID: 991632473 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:68670106-68670128 |
| Sequence | GATTCAGCAGGTCTGGAGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3015 | |||
| Summary | {0: 5, 1: 62, 2: 302, 3: 861, 4: 1785} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 991632473_991632480 | 28 | Left | 991632473 | 5:68670106-68670128 | CCCCACTCCAGACCTGCTGAATC | 0: 5 1: 62 2: 302 3: 861 4: 1785 |
||
| Right | 991632480 | 5:68670157-68670179 | TGATACTAATGCACATTAAAGGG | No data | ||||
| 991632473_991632478 | 5 | Left | 991632473 | 5:68670106-68670128 | CCCCACTCCAGACCTGCTGAATC | 0: 5 1: 62 2: 302 3: 861 4: 1785 |
||
| Right | 991632478 | 5:68670134-68670156 | CTATTTTAACAGTATTCACTAGG | No data | ||||
| 991632473_991632479 | 27 | Left | 991632473 | 5:68670106-68670128 | CCCCACTCCAGACCTGCTGAATC | 0: 5 1: 62 2: 302 3: 861 4: 1785 |
||
| Right | 991632479 | 5:68670156-68670178 | GTGATACTAATGCACATTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 991632473 | Original CRISPR | GATTCAGCAGGTCTGGAGTG GGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||