ID: 991632473

View in Genome Browser
Species Human (GRCh38)
Location 5:68670106-68670128
Sequence GATTCAGCAGGTCTGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3015
Summary {0: 5, 1: 62, 2: 302, 3: 861, 4: 1785}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632473_991632480 28 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC 0: 5
1: 62
2: 302
3: 861
4: 1785
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data
991632473_991632478 5 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC 0: 5
1: 62
2: 302
3: 861
4: 1785
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632473_991632479 27 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC 0: 5
1: 62
2: 302
3: 861
4: 1785
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632473 Original CRISPR GATTCAGCAGGTCTGGAGTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr