ID: 991632473

View in Genome Browser
Species Human (GRCh38)
Location 5:68670106-68670128
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632473_991632480 28 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC No data
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data
991632473_991632478 5 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632473_991632479 27 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC No data
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632473 Original CRISPR GATTCAGCAGGTCTGGAGTG GGG (reversed) Intergenic