ID: 991632474

View in Genome Browser
Species Human (GRCh38)
Location 5:68670107-68670129
Sequence TGATTCAGCAGGTCTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3722
Summary {0: 6, 1: 87, 2: 357, 3: 1087, 4: 2185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632474_991632478 4 Left 991632474 5:68670107-68670129 CCCACTCCAGACCTGCTGAATCA 0: 6
1: 87
2: 357
3: 1087
4: 2185
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632474_991632480 27 Left 991632474 5:68670107-68670129 CCCACTCCAGACCTGCTGAATCA 0: 6
1: 87
2: 357
3: 1087
4: 2185
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data
991632474_991632479 26 Left 991632474 5:68670107-68670129 CCCACTCCAGACCTGCTGAATCA 0: 6
1: 87
2: 357
3: 1087
4: 2185
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632474 Original CRISPR TGATTCAGCAGGTCTGGAGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr