ID: 991632475

View in Genome Browser
Species Human (GRCh38)
Location 5:68670108-68670130
Sequence TTGATTCAGCAGGTCTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632475_991632478 3 Left 991632475 5:68670108-68670130 CCACTCCAGACCTGCTGAATCAA No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632475_991632480 26 Left 991632475 5:68670108-68670130 CCACTCCAGACCTGCTGAATCAA No data
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data
991632475_991632479 25 Left 991632475 5:68670108-68670130 CCACTCCAGACCTGCTGAATCAA No data
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632475 Original CRISPR TTGATTCAGCAGGTCTGGAG TGG (reversed) Intergenic