ID: 991632476 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:68670113-68670135 |
| Sequence | AGATTTTGATTCAGCAGGTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 991632476_991632478 | -2 | Left | 991632476 | 5:68670113-68670135 | CCAGACCTGCTGAATCAAAATCT | No data | ||
| Right | 991632478 | 5:68670134-68670156 | CTATTTTAACAGTATTCACTAGG | No data | ||||
| 991632476_991632480 | 21 | Left | 991632476 | 5:68670113-68670135 | CCAGACCTGCTGAATCAAAATCT | No data | ||
| Right | 991632480 | 5:68670157-68670179 | TGATACTAATGCACATTAAAGGG | No data | ||||
| 991632476_991632479 | 20 | Left | 991632476 | 5:68670113-68670135 | CCAGACCTGCTGAATCAAAATCT | No data | ||
| Right | 991632479 | 5:68670156-68670178 | GTGATACTAATGCACATTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 991632476 | Original CRISPR | AGATTTTGATTCAGCAGGTC TGG (reversed) | Intergenic | ||